ID: 901704809

View in Genome Browser
Species Human (GRCh38)
Location 1:11065378-11065400
Sequence ACTCCAGCCTATCTTAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901704806_901704809 1 Left 901704806 1:11065354-11065376 CCAGTCTAGTCCTAGCTAAAACA No data
Right 901704809 1:11065378-11065400 ACTCCAGCCTATCTTAGGACAGG No data
901704807_901704809 -9 Left 901704807 1:11065364-11065386 CCTAGCTAAAACAAACTCCAGCC No data
Right 901704809 1:11065378-11065400 ACTCCAGCCTATCTTAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901704809 Original CRISPR ACTCCAGCCTATCTTAGGAC AGG Intergenic