ID: 901704810 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:11065379-11065401 |
Sequence | CTCCAGCCTATCTTAGGACA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
901704806_901704810 | 2 | Left | 901704806 | 1:11065354-11065376 | CCAGTCTAGTCCTAGCTAAAACA | No data | ||
Right | 901704810 | 1:11065379-11065401 | CTCCAGCCTATCTTAGGACAGGG | No data | ||||
901704807_901704810 | -8 | Left | 901704807 | 1:11065364-11065386 | CCTAGCTAAAACAAACTCCAGCC | No data | ||
Right | 901704810 | 1:11065379-11065401 | CTCCAGCCTATCTTAGGACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
901704810 | Original CRISPR | CTCCAGCCTATCTTAGGACA GGG | Intergenic | ||