ID: 901704810

View in Genome Browser
Species Human (GRCh38)
Location 1:11065379-11065401
Sequence CTCCAGCCTATCTTAGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901704806_901704810 2 Left 901704806 1:11065354-11065376 CCAGTCTAGTCCTAGCTAAAACA No data
Right 901704810 1:11065379-11065401 CTCCAGCCTATCTTAGGACAGGG No data
901704807_901704810 -8 Left 901704807 1:11065364-11065386 CCTAGCTAAAACAAACTCCAGCC No data
Right 901704810 1:11065379-11065401 CTCCAGCCTATCTTAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901704810 Original CRISPR CTCCAGCCTATCTTAGGACA GGG Intergenic