ID: 901704811

View in Genome Browser
Species Human (GRCh38)
Location 1:11065381-11065403
Sequence AGCCCTGTCCTAAGATAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901704811_901704813 -1 Left 901704811 1:11065381-11065403 CCAGCCTATCTTAGGACAGGGCT No data
Right 901704813 1:11065403-11065425 TGTTCTCTGCTGTTCAAGAGTGG No data
901704811_901704815 13 Left 901704811 1:11065381-11065403 CCAGCCTATCTTAGGACAGGGCT No data
Right 901704815 1:11065417-11065439 CAAGAGTGGGAGCTCTCTGACGG No data
901704811_901704814 0 Left 901704811 1:11065381-11065403 CCAGCCTATCTTAGGACAGGGCT No data
Right 901704814 1:11065404-11065426 GTTCTCTGCTGTTCAAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901704811 Original CRISPR AGCCCTGTCCTAAGATAGGC TGG (reversed) Intergenic