ID: 901704812

View in Genome Browser
Species Human (GRCh38)
Location 1:11065385-11065407
Sequence GAACAGCCCTGTCCTAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901704812_901704815 9 Left 901704812 1:11065385-11065407 CCTATCTTAGGACAGGGCTGTTC No data
Right 901704815 1:11065417-11065439 CAAGAGTGGGAGCTCTCTGACGG No data
901704812_901704816 27 Left 901704812 1:11065385-11065407 CCTATCTTAGGACAGGGCTGTTC No data
Right 901704816 1:11065435-11065457 GACGGCAGTGATGTGTGATTTGG No data
901704812_901704813 -5 Left 901704812 1:11065385-11065407 CCTATCTTAGGACAGGGCTGTTC No data
Right 901704813 1:11065403-11065425 TGTTCTCTGCTGTTCAAGAGTGG No data
901704812_901704814 -4 Left 901704812 1:11065385-11065407 CCTATCTTAGGACAGGGCTGTTC No data
Right 901704814 1:11065404-11065426 GTTCTCTGCTGTTCAAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901704812 Original CRISPR GAACAGCCCTGTCCTAAGAT AGG (reversed) Intergenic