ID: 901704813

View in Genome Browser
Species Human (GRCh38)
Location 1:11065403-11065425
Sequence TGTTCTCTGCTGTTCAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901704812_901704813 -5 Left 901704812 1:11065385-11065407 CCTATCTTAGGACAGGGCTGTTC No data
Right 901704813 1:11065403-11065425 TGTTCTCTGCTGTTCAAGAGTGG No data
901704811_901704813 -1 Left 901704811 1:11065381-11065403 CCAGCCTATCTTAGGACAGGGCT No data
Right 901704813 1:11065403-11065425 TGTTCTCTGCTGTTCAAGAGTGG No data
901704807_901704813 16 Left 901704807 1:11065364-11065386 CCTAGCTAAAACAAACTCCAGCC No data
Right 901704813 1:11065403-11065425 TGTTCTCTGCTGTTCAAGAGTGG No data
901704806_901704813 26 Left 901704806 1:11065354-11065376 CCAGTCTAGTCCTAGCTAAAACA No data
Right 901704813 1:11065403-11065425 TGTTCTCTGCTGTTCAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901704813 Original CRISPR TGTTCTCTGCTGTTCAAGAG TGG Intergenic