ID: 901704815

View in Genome Browser
Species Human (GRCh38)
Location 1:11065417-11065439
Sequence CAAGAGTGGGAGCTCTCTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901704811_901704815 13 Left 901704811 1:11065381-11065403 CCAGCCTATCTTAGGACAGGGCT No data
Right 901704815 1:11065417-11065439 CAAGAGTGGGAGCTCTCTGACGG No data
901704812_901704815 9 Left 901704812 1:11065385-11065407 CCTATCTTAGGACAGGGCTGTTC No data
Right 901704815 1:11065417-11065439 CAAGAGTGGGAGCTCTCTGACGG No data
901704807_901704815 30 Left 901704807 1:11065364-11065386 CCTAGCTAAAACAAACTCCAGCC No data
Right 901704815 1:11065417-11065439 CAAGAGTGGGAGCTCTCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901704815 Original CRISPR CAAGAGTGGGAGCTCTCTGA CGG Intergenic