ID: 901704816

View in Genome Browser
Species Human (GRCh38)
Location 1:11065435-11065457
Sequence GACGGCAGTGATGTGTGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901704812_901704816 27 Left 901704812 1:11065385-11065407 CCTATCTTAGGACAGGGCTGTTC No data
Right 901704816 1:11065435-11065457 GACGGCAGTGATGTGTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901704816 Original CRISPR GACGGCAGTGATGTGTGATT TGG Intergenic