ID: 901706214

View in Genome Browser
Species Human (GRCh38)
Location 1:11075325-11075347
Sequence TTAGTATTACATATCTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 378}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901706206_901706214 29 Left 901706206 1:11075273-11075295 CCTCCAAAAGTGCTGGGATTACA 0: 2827
1: 300992
2: 269180
3: 150983
4: 141420
Right 901706214 1:11075325-11075347 TTAGTATTACATATCTTTATAGG 0: 1
1: 0
2: 1
3: 32
4: 378
901706210_901706214 -2 Left 901706210 1:11075304-11075326 CCACCACGCCAGGCCTGAAATTT 0: 1
1: 16
2: 230
3: 1552
4: 7780
Right 901706214 1:11075325-11075347 TTAGTATTACATATCTTTATAGG 0: 1
1: 0
2: 1
3: 32
4: 378
901706208_901706214 26 Left 901706208 1:11075276-11075298 CCAAAAGTGCTGGGATTACAGGT 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
Right 901706214 1:11075325-11075347 TTAGTATTACATATCTTTATAGG 0: 1
1: 0
2: 1
3: 32
4: 378
901706205_901706214 30 Left 901706205 1:11075272-11075294 CCCTCCAAAAGTGCTGGGATTAC 0: 55
1: 3117
2: 4160
3: 3327
4: 3359
Right 901706214 1:11075325-11075347 TTAGTATTACATATCTTTATAGG 0: 1
1: 0
2: 1
3: 32
4: 378
901706211_901706214 -5 Left 901706211 1:11075307-11075329 CCACGCCAGGCCTGAAATTTAGT 0: 1
1: 0
2: 12
3: 110
4: 922
Right 901706214 1:11075325-11075347 TTAGTATTACATATCTTTATAGG 0: 1
1: 0
2: 1
3: 32
4: 378
901706212_901706214 -10 Left 901706212 1:11075312-11075334 CCAGGCCTGAAATTTAGTATTAC 0: 1
1: 0
2: 2
3: 33
4: 337
Right 901706214 1:11075325-11075347 TTAGTATTACATATCTTTATAGG 0: 1
1: 0
2: 1
3: 32
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901706214 Original CRISPR TTAGTATTACATATCTTTAT AGG Intronic
901706214 1:11075325-11075347 TTAGTATTACATATCTTTATAGG + Intronic
901977756 1:13008938-13008960 TTATTATAACATATATTTCTAGG + Intronic
902004329 1:13219997-13220019 TTATTATAACATATATTTCTAGG - Intergenic
902023549 1:13365735-13365757 TTATTATAACATATATTTCTAGG - Intergenic
906748064 1:48235427-48235449 CTAGTCTTACATAACTTAATAGG + Intronic
907865321 1:58393976-58393998 TAATAATTACATATATTTATGGG - Intronic
908180546 1:61600455-61600477 TTAATACTAAATATCTTAATTGG - Intergenic
908868574 1:68581063-68581085 TTATTATAAAATATTTTTATTGG + Intergenic
910317956 1:85909782-85909804 TTAGTATCACATAGCATTCTGGG + Intronic
910751242 1:90633544-90633566 TTATTATTGCATGCCTTTATAGG - Intergenic
911905245 1:103559215-103559237 TTATTATGCCATATTTTTATCGG + Intronic
911909483 1:103614842-103614864 TTATTATGCCATATTTTTATCGG + Intergenic
912222667 1:107696176-107696198 ACAGTATTACACATATTTATGGG + Intronic
918117966 1:181512881-181512903 ATAGTATTACAGAACTATATTGG + Intronic
918328828 1:183436372-183436394 TTTGTTGTACATATTTTTATAGG - Intergenic
918598323 1:186319995-186320017 CTAGTAGTACCTATATTTATTGG + Intronic
919069863 1:192740241-192740263 ATAATATTATATATATTTATGGG - Intergenic
919656745 1:200204052-200204074 TATGTATTACATATCTATAATGG + Intergenic
920772536 1:208902993-208903015 TTATTTTAAAATATCTTTATAGG + Intergenic
921242771 1:213203188-213203210 TTTGTATTATATATATTTACTGG + Intronic
921578539 1:216867499-216867521 TTAAGATAACATATCTTTGTGGG + Intronic
922267804 1:224002237-224002259 TATGTATTACATGTCTTTAGTGG + Intergenic
1063260305 10:4380794-4380816 TTAGAATTACAAATATATATTGG - Intergenic
1064885246 10:20104479-20104501 TCTGTAATACATATTTTTATAGG + Intronic
1065158638 10:22895826-22895848 ATACTATTACATATGTTAATTGG - Intergenic
1065272371 10:24048204-24048226 CATGTATTACATATCTATATGGG + Intronic
1066210534 10:33233030-33233052 TTAGAATTTCATATCCATATTGG - Intronic
1066725901 10:38393375-38393397 TATGTATTACATGTCTTTAGTGG - Intergenic
1067056252 10:43053593-43053615 TTTTTATTTCATATCGTTATTGG + Intergenic
1068081670 10:52325919-52325941 TTAGTTTTTGACATCTTTATTGG + Intergenic
1068320147 10:55402248-55402270 TAATAATTACATATATTTATGGG + Intronic
1068605339 10:58999135-58999157 TTAGGATTACAGATCCTTGTAGG + Intergenic
1069154930 10:65016967-65016989 TTAGGATTACATATTTTTTTTGG + Intergenic
1071245572 10:83758858-83758880 TTATTATTATATTTCTTTAAAGG - Intergenic
1072409516 10:95187089-95187111 TTATTAATACTTATCTTAATGGG - Intergenic
1072908805 10:99481727-99481749 TAGGTCTTACATATCATTATAGG - Intergenic
1073906675 10:108288890-108288912 TTAATATTACATTTGCTTATTGG + Intergenic
1074199637 10:111223402-111223424 TTACTAATAAACATCTTTATGGG - Intergenic
1075163395 10:120044149-120044171 GGAGTATTCTATATCTTTATTGG - Intergenic
1075167779 10:120084787-120084809 ATAATATTACATTCCTTTATTGG + Intergenic
1075552787 10:123405215-123405237 TTTGTATTAGATTTCTTTCTGGG + Intergenic
1076035044 10:127193078-127193100 TTAATATTTCATAACATTATGGG - Intronic
1076297930 10:129401904-129401926 TTACTAATAGATATCTTTAAAGG - Intergenic
1079277332 11:19053442-19053464 TAACAATTACATATATTTATGGG - Intergenic
1079889041 11:26027614-26027636 TCAGTATTTCATAGTTTTATAGG + Intergenic
1079975032 11:27080412-27080434 TTAGTAATATATGTCATTATTGG + Intronic
1080361005 11:31513865-31513887 TAAGTATTAAATATCTTTTCTGG + Intronic
1080401138 11:31936822-31936844 TTAGTATTTCCTGTTTTTATAGG + Intronic
1081237759 11:40666272-40666294 TTAATATTACATATTTTTATAGG + Intronic
1082040820 11:47683449-47683471 TTTTTATCATATATCTTTATGGG + Intronic
1082050762 11:47768599-47768621 TAAGTATTAGATATTTTTAGTGG - Intergenic
1082699260 11:56407791-56407813 TTCGTATTACATGTTTTTGTGGG - Intergenic
1084807001 11:71585896-71585918 TTAATATTAATTATCATTATCGG + Intronic
1085976037 11:81656319-81656341 AGAGTCTTACATATCTTTGTGGG + Intergenic
1087537222 11:99464464-99464486 ATAGTTTTAAATATATTTATAGG + Intronic
1087743601 11:101916910-101916932 TTAGTGTTGTATTTCTTTATAGG - Intronic
1088078960 11:105886217-105886239 ATAGTAGTATATATATTTATGGG + Intronic
1088339444 11:108746368-108746390 TCAGTATTGCATTTCTTTTTAGG + Intronic
1088614586 11:111612358-111612380 TTAGTATTATACATATTTCTGGG + Intronic
1089824012 11:121256147-121256169 TTAGTATTTCATATCATTCATGG + Intergenic
1091039590 11:132264264-132264286 TTCATATTTCATATATTTATTGG + Intronic
1092110400 12:5958083-5958105 TTAGTACTATATCTCTTTATTGG - Intronic
1092432919 12:8423218-8423240 TTAATATTAATTATCATTATCGG - Intergenic
1093814363 12:23526765-23526787 TTAGTCTTAAATTTCTTTTTGGG - Intergenic
1095717414 12:45362216-45362238 TAAGTAGTACATATTTTTCTAGG + Intronic
1097346010 12:58493298-58493320 TTATTGTTACATTTATTTATAGG + Intergenic
1097362324 12:58671550-58671572 TAAGTCTTACAGATATTTATGGG + Intronic
1098075867 12:66730183-66730205 TTAGTATGGCATAAATTTATTGG - Intronic
1098652937 12:72996501-72996523 TTAGTACTCTATATCTTTTTCGG + Intergenic
1099773093 12:87089041-87089063 TTTATATTATATAACTTTATGGG - Intergenic
1100440344 12:94611329-94611351 TTAGTATTCAATATTTTAATGGG - Intronic
1100618963 12:96253642-96253664 TTAGGATTACAGATATTTGTGGG + Intronic
1103306368 12:119967812-119967834 TTGGTATTTCATTTGTTTATTGG - Intergenic
1103781446 12:123401547-123401569 TTACTATTAAATAAGTTTATGGG + Intronic
1104144692 12:126021527-126021549 TTAGTTTTGCATGTATTTATTGG + Intergenic
1105427020 13:20302609-20302631 ATAGTATTATATCTATTTATAGG + Intergenic
1105814814 13:24025335-24025357 TTATTATTATATATATTTTTTGG - Intronic
1106690132 13:32106177-32106199 TTAATATTAAATATATCTATAGG + Intronic
1106955998 13:34939982-34940004 TTGGTATTACATGTGTTTATAGG + Intergenic
1108010531 13:46003539-46003561 TTATTATTATATAACTTTAAAGG + Intronic
1108809019 13:54197672-54197694 TTATGATTACATATTTCTATTGG - Intergenic
1108981319 13:56519367-56519389 TTAGTATTAGATATCACTCTAGG - Intergenic
1109358373 13:61263936-61263958 TGACAATTACATATATTTATGGG + Intergenic
1109426471 13:62170678-62170700 TTATTATTAAATACCTTTAGAGG + Intergenic
1109569981 13:64175307-64175329 TTATTATTACATTTCTTCCTTGG - Intergenic
1109883122 13:68507568-68507590 TGAGTATTATTTATTTTTATGGG + Intergenic
1109886068 13:68546944-68546966 TCTGTATTAAATGTCTTTATGGG - Intergenic
1109926890 13:69153890-69153912 TTGATATTACATATCTTCAGAGG + Intergenic
1110248133 13:73351126-73351148 TTTGTTTAACATATATTTATGGG - Intergenic
1110288423 13:73776887-73776909 TTAGTATTACCTAAATTGATTGG - Intronic
1110348175 13:74473393-74473415 TTATTATATCATATGTTTATTGG - Intergenic
1110938182 13:81318559-81318581 ATAATATTTCCTATCTTTATGGG + Intergenic
1111187244 13:84754503-84754525 TTAGTAGTATATATTTTTTTTGG + Intergenic
1114576654 14:23720579-23720601 TTAGTTTTAGATATATTCATTGG - Intergenic
1115730542 14:36264490-36264512 TTAGTTTTACATAAAGTTATTGG - Intergenic
1116359022 14:43969364-43969386 TAAGAATTACATATATTTATGGG - Intergenic
1116527333 14:45921426-45921448 TTATTATTAAAAATTTTTATTGG - Intergenic
1116589853 14:46758317-46758339 TTAGCATAACATATTTTTAAAGG - Intergenic
1116645141 14:47518630-47518652 ATAACATTAGATATCTTTATAGG + Intronic
1117789935 14:59329852-59329874 TCAGTATTAAATATCTTAAGGGG - Intronic
1118833507 14:69458107-69458129 TTATAATTATATATATTTATAGG - Intronic
1120426580 14:84355442-84355464 TTAGTCTTATGTGTCTTTATAGG - Intergenic
1120572055 14:86131318-86131340 TTCATCTTTCATATCTTTATTGG - Intergenic
1121352695 14:93185791-93185813 TAAGTTTTACATTTCTTAATAGG + Intronic
1121909117 14:97773033-97773055 TTAGTTTTCCATAGCTGTATAGG - Intergenic
1125820356 15:42624973-42624995 TAAATATTACTTATCTCTATGGG - Intronic
1126498185 15:49315955-49315977 TTAGGATTACATATTTCTTTAGG - Intronic
1127408301 15:58677249-58677271 TTATTATTACATATCAGTAGTGG - Intronic
1128845335 15:70889682-70889704 TGAGTGTTACATATCTTTAGGGG - Intronic
1130361086 15:83186864-83186886 TTATTTTTCAATATCTTTATGGG - Intronic
1131203417 15:90420850-90420872 TTATTTTTAAATGTCTTTATAGG + Intronic
1132356668 15:101176160-101176182 TTAGTATTATTTATGTGTATCGG - Exonic
1133491029 16:6268239-6268261 CTAGATTTACATCTCTTTATGGG + Intronic
1135388298 16:22065078-22065100 TTAGTATTTAATGTCTTTATGGG + Intronic
1135395171 16:22125856-22125878 TTAGCATTCAATATTTTTATAGG - Intronic
1138953078 16:61937677-61937699 CTAGTATCACATATCTATAAAGG + Intronic
1139160505 16:64501717-64501739 TTAAAATTACATAAATTTATGGG + Intergenic
1139297472 16:65915345-65915367 TAGGTAGTTCATATCTTTATAGG + Intergenic
1142920784 17:3183773-3183795 TTATAATTGCATATATTTATGGG - Intergenic
1143728003 17:8863247-8863269 TTATAATTGCATATATTTATGGG + Intronic
1146018077 17:29249521-29249543 CTAGTAGTAAATATCTTTATGGG - Intronic
1147478747 17:40738799-40738821 TAAGTAATACAAATCTTTAGTGG + Intergenic
1147535742 17:41321762-41321784 TTATCATTGCATATTTTTATAGG + Intergenic
1149079974 17:52643636-52643658 GTAGTATTACATATATTTGGGGG - Intergenic
1149202934 17:54208880-54208902 TTATTTTTACATATTTTTCTGGG - Intergenic
1149408354 17:56378027-56378049 TTGCTATTACAAATCTTTGTAGG - Intronic
1149437094 17:56642342-56642364 TTAGTATTAGATATCTATGCTGG - Intergenic
1150185909 17:63181213-63181235 TTAGTGATACATATCTTTAATGG + Intronic
1152484377 17:80580523-80580545 GTATTTTTACATATGTTTATGGG + Intronic
1153117044 18:1671039-1671061 TTAGTATTAGTTTTTTTTATTGG - Intergenic
1154041699 18:10862189-10862211 TAACTATTATATATATTTATGGG - Intronic
1155738931 18:29261640-29261662 TTAGTATTTGATATCATAATAGG - Intergenic
1155847447 18:30727134-30727156 CAACTATTACATATTTTTATTGG - Intergenic
1155871777 18:31039049-31039071 TTATTATAAAATATCTTTAAAGG - Intronic
1155915011 18:31548768-31548790 TTAGTTTTACATTTGTTTTTTGG + Exonic
1155999248 18:32366487-32366509 TAAATTTTACATATTTTTATAGG + Intronic
1156419025 18:36930466-36930488 TTCTTATGACATATTTTTATAGG + Intronic
1156598019 18:38570339-38570361 TTTGTACTTCATACCTTTATGGG + Intergenic
1156972328 18:43171157-43171179 TTAATATTGTATAGCTTTATCGG - Intergenic
1158375770 18:56863089-56863111 TTAATCTAACATATCTTTAAAGG + Intronic
1158533377 18:58283757-58283779 ATAGGATTTCATATCTTTTTGGG - Intronic
1158749634 18:60244171-60244193 TGAGTTTTTCATATGTTTATTGG - Intergenic
1158907439 18:62027447-62027469 TTCATCTTACATATCTTGATTGG - Intergenic
1159422830 18:68245480-68245502 TAATTATTTCATATGTTTATAGG - Intergenic
1159490787 18:69131787-69131809 TAAATATTTCATATATTTATTGG + Intergenic
1160997632 19:1890941-1890963 TTAGTTTTATTTATGTTTATGGG + Intergenic
1161091966 19:2365169-2365191 TTAGTATCACTCATGTTTATCGG + Intergenic
1161982053 19:7635086-7635108 TTAGTACTTCATATCTTTTGGGG + Intronic
1163200518 19:15764799-15764821 TTAATATTATATATATTTATGGG - Intergenic
1164081361 19:21864343-21864365 ATAGTAGTATATATATTTATGGG + Intergenic
1164495036 19:28752960-28752982 TTATTACTGCATATCTCTATAGG + Intergenic
1165670703 19:37676410-37676432 TTATTATTACATATGTTAAATGG - Intronic
1168568642 19:57445558-57445580 TTAGATTTACATATATTAATAGG - Intronic
925550981 2:5074135-5074157 TTAGTATTCCCCATCTTCATAGG - Intergenic
926581756 2:14637509-14637531 TTATTATTGCATATTTTTAGAGG - Exonic
926594303 2:14773638-14773660 GTAGTCTTAAATAACTTTATTGG - Intergenic
926989804 2:18666146-18666168 TTATAATTGCATATATTTATAGG - Intergenic
927284866 2:21346205-21346227 TTAGTATCACATCTTTTTAATGG - Intergenic
927353625 2:22148184-22148206 TTAGTAATACTGCTCTTTATTGG + Intergenic
927466157 2:23338352-23338374 TCAGAATTATATATATTTATGGG - Intergenic
927807725 2:26162615-26162637 TTAGCATTACATGTCATTCTAGG - Intergenic
928492826 2:31801997-31802019 TTGCTATTTAATATCTTTATAGG - Intergenic
931582409 2:63791357-63791379 TTAGTATTCCAATTCTTTATGGG + Intronic
932584139 2:73013249-73013271 TTTGTATTACACATCTCTTTTGG - Intronic
932898464 2:75669110-75669132 TTAGTTTTACATATCCTTTTAGG + Intronic
933092072 2:78133827-78133849 TTCCTCTTACATATCCTTATGGG + Intergenic
933919423 2:87029558-87029580 TGAGTTTTACATATGTTTAGTGG - Intergenic
934003571 2:87740349-87740371 TGAGTTTTACATATGTTTAGTGG + Intergenic
934103096 2:88671715-88671737 TTAATATTAAATATTTTTAGTGG + Intergenic
934865109 2:97801635-97801657 TTATTATTACAAACCTTCATGGG + Intronic
935357241 2:102213484-102213506 TAATAATTACATATATTTATGGG - Intronic
936624903 2:114138245-114138267 ATAGTATAATATATGTTTATGGG - Intergenic
939273338 2:139968412-139968434 TAGGTATTACATCTCTTCATTGG + Intergenic
939812636 2:146853473-146853495 GTAGTTTTACATAGGTTTATGGG - Intergenic
940378150 2:152981135-152981157 TAAGTATTAAATGTCTTTCTGGG + Intergenic
940471534 2:154106755-154106777 TTATAATTATATATATTTATGGG + Intronic
940873480 2:158879584-158879606 TTAATATTAATTATCATTATCGG + Intergenic
941059954 2:160835715-160835737 TTAGTATTTGTCATCTTTATTGG + Intergenic
942148095 2:173045930-173045952 TTAATATTACATGTGTTAATGGG + Intronic
942698371 2:178673891-178673913 TTGGTATTACATTTGCTTATAGG - Intronic
942777643 2:179603251-179603273 ACAGTATTACCCATCTTTATAGG + Intronic
942895744 2:181052162-181052184 TAAGTATTACATTTTCTTATAGG - Intronic
943437050 2:187878794-187878816 TTATTTTTTCATATATTTATAGG - Intergenic
944329819 2:198452497-198452519 CTATTATTACATCTGTTTATTGG + Intronic
944364936 2:198906959-198906981 TCAGGATTACATATCTTAATAGG + Intergenic
944603903 2:201332136-201332158 TTATAATTATATATATTTATGGG + Intronic
944615751 2:201458179-201458201 TAGGTGTTACATTTCTTTATTGG + Intronic
945245884 2:207716807-207716829 TTAGTATTAAATGTTCTTATGGG + Intronic
945269154 2:207921365-207921387 TTATTATTAAATATTTTTAATGG + Intronic
945350916 2:208778245-208778267 ATGTTATTACTTATCTTTATTGG - Intronic
948155846 2:235780347-235780369 TTAGTATTACTAAGTTTTATGGG - Intronic
1169099154 20:2930829-2930851 TTAGGACTTCATATCTTTTTTGG + Intronic
1169706449 20:8510878-8510900 TAATGATTACATATGTTTATGGG + Intronic
1169822253 20:9724554-9724576 TCAGTATCACATTTCTTTCTAGG + Intronic
1170001726 20:11622051-11622073 TAAGTATTATATATTTATATAGG + Intergenic
1170764400 20:19277763-19277785 TTATTTTTACATCTCTTAATTGG + Intronic
1170911030 20:20568338-20568360 TTAGTATTACATAAGTTATTAGG + Intronic
1172250366 20:33475307-33475329 TGAATTTCACATATCTTTATCGG + Intergenic
1176948946 21:15020808-15020830 CTAGTATTTCATGTCTTTAGTGG - Intronic
1178568797 21:33715113-33715135 TTGGTATTTCATATTTTAATAGG - Intronic
1178692973 21:34765017-34765039 TTAATTCTACAAATCTTTATGGG - Intergenic
1180904247 22:19397361-19397383 TTTGGATTACAGATCTATATGGG - Intronic
1184655370 22:45938876-45938898 GTAATATTACACATATTTATGGG - Intronic
949320318 3:2803170-2803192 TTGGTTTTTCATATATTTATGGG - Intronic
949517015 3:4816891-4816913 TTATTTCTACATTTCTTTATTGG + Intronic
950951129 3:17000326-17000348 TTATTATTATATATATTTGTGGG + Intronic
951060073 3:18195692-18195714 CTAATATTACATCTATTTATGGG + Intronic
951255261 3:20441612-20441634 TAAGTTTAACATTTCTTTATTGG - Intergenic
951337386 3:21441120-21441142 TTATTATTTCAAGTCTTTATGGG - Intronic
951392453 3:22123322-22123344 TTAGTTTTTAAAATCTTTATGGG + Intronic
952365756 3:32673558-32673580 TGAGTATTACAGCTCTTTAAAGG + Intergenic
955478225 3:59361193-59361215 TTAGTTATACTTATTTTTATTGG + Intergenic
956935155 3:74092148-74092170 TTATAATTATATATATTTATGGG + Intergenic
956959516 3:74382251-74382273 TTATAATTATATATTTTTATGGG + Intronic
957346586 3:78968816-78968838 TTTGTATTACATTTCATTACTGG + Intronic
957373762 3:79330523-79330545 ATTGTATTACAAATTTTTATTGG + Intronic
957422451 3:79988885-79988907 TTAGTATTATATATATTTTAAGG + Intergenic
957446805 3:80323971-80323993 TTAATTTTACATATCCTTTTAGG - Intergenic
957796356 3:85013609-85013631 TTAGTAATTCATATCTTTAAAGG - Intronic
959511483 3:107217871-107217893 TTACCATTAGATATTTTTATAGG + Intergenic
959847178 3:111046857-111046879 GTACTGTTACATATCTTCATTGG - Intergenic
960105485 3:113791529-113791551 TTACTATTACTCATCTTTGTAGG + Intronic
960412185 3:117340890-117340912 TTAGTAATACATATGTTTTCTGG - Intergenic
963817550 3:149849095-149849117 ATAGTATTACGTTTCTTTTTGGG - Intronic
964373046 3:156021502-156021524 TTTGTTTTACATACCTGTATTGG - Intergenic
964465717 3:156989440-156989462 TTGAGATTACATATCTGTATAGG - Intronic
964775897 3:160276719-160276741 TTAGTACTACACATCTCTCTTGG + Intronic
964966993 3:162506723-162506745 ATAGTATTAAATATTGTTATAGG - Intergenic
965084331 3:164075032-164075054 TCAGTGTTACATACCTTAATTGG - Intergenic
965382407 3:168006198-168006220 TAACTTTTGCATATCTTTATAGG + Intergenic
965616532 3:170599127-170599149 TTACAATTAGATATTTTTATAGG + Intronic
966138866 3:176732247-176732269 TTAGTATTACTGTGCTTTATCGG - Intergenic
967654128 3:192025373-192025395 TTAGAATTACTTTTCTTTAAGGG - Intergenic
968820721 4:2848814-2848836 TTAATATTACATCTCCATATTGG + Intronic
970140107 4:12972918-12972940 TTAGTATTACATACCTTACCTGG + Intergenic
970201306 4:13610179-13610201 TTATTGTTACATATGTATATTGG - Intronic
971338172 4:25743544-25743566 TTCGTCTTACATATATTGATTGG - Intergenic
971650179 4:29261661-29261683 ATACTATTTCATGTCTTTATGGG + Intergenic
971766729 4:30841954-30841976 TTAATATTATATATTTTTTTAGG + Intronic
972005534 4:34099112-34099134 TTATAATTGCATATATTTATGGG - Intergenic
972432188 4:38993678-38993700 TTAATTTTACATATCTATATCGG + Intronic
972594479 4:40517680-40517702 ATAGTAGTATATATATTTATGGG - Intronic
974155353 4:58064456-58064478 TAAGTATTAAATATATTTATTGG + Intergenic
974256360 4:59459756-59459778 TTAAAATTAAACATCTTTATTGG + Intergenic
974866319 4:67585290-67585312 TTAGAATTATAGATATTTATGGG - Intronic
975094399 4:70441105-70441127 GTGGTATTACATGTATTTATAGG + Intronic
976526210 4:86092207-86092229 TTATTTTAATATATCTTTATGGG + Intronic
977103998 4:92856981-92857003 TTAGTATTATATATGTTAAAGGG + Intronic
977237114 4:94521547-94521569 TTAGAATTACCTTTCTTTCTAGG - Intronic
977284968 4:95092283-95092305 TTAGTAATTCATATCATTTTTGG + Intronic
977334919 4:95685669-95685691 TTTTTATTACATATATTTAAGGG - Intergenic
977374061 4:96178133-96178155 TTTTTATTGCATATATTTATGGG - Intergenic
977739603 4:100462124-100462146 TTATTATTACATTTATTTCTGGG - Intronic
977924960 4:102689500-102689522 ATAGTAATACAGATCTTCATGGG - Intronic
977985900 4:103382664-103382686 TTGGTCTTGCATGTCTTTATTGG - Intergenic
978975399 4:114863995-114864017 TTATAATTCCATATTTTTATAGG + Intronic
979335789 4:119460450-119460472 TATGTATTACATGTCTTTAGTGG + Intergenic
979365630 4:119819307-119819329 TTATAATTATATATATTTATGGG + Intergenic
979459589 4:120966460-120966482 TTAGCATTACAAATAATTATTGG + Intergenic
980262586 4:130471497-130471519 TAAGTATTCCATTTCTATATCGG - Intergenic
980835387 4:138185688-138185710 TTAGTATTAGAAATGTTTATAGG - Intronic
981328000 4:143474247-143474269 TTACTATTACTTATGGTTATTGG + Exonic
981520582 4:145657810-145657832 TTAGTATTACATATAATCCTTGG + Exonic
981622442 4:146717623-146717645 TTATAATTATATATATTTATGGG + Intronic
982304667 4:153918054-153918076 ATAGTACTACATATTTTTATTGG - Intergenic
983370874 4:166856436-166856458 TAACAATTACATATATTTATGGG - Intronic
983786251 4:171733235-171733257 TTATTATTCCAGAGCTTTATTGG - Intergenic
984459848 4:180020312-180020334 ATCATATTACATCTCTTTATAGG - Intergenic
985191981 4:187384311-187384333 TTGGTAGTATGTATCTTTATAGG - Intergenic
986529772 5:8724204-8724226 TTAGAATTACATTTCTTTACAGG - Intergenic
986541276 5:8846612-8846634 TTATTTTTACATATCTAAATAGG + Intergenic
988324867 5:29751034-29751056 TTAATATCACATATATTTAATGG - Intergenic
988365956 5:30299345-30299367 TTAGACTAACATATCTTTTTTGG - Intergenic
988862747 5:35301716-35301738 TGTGTATTAGATATTTTTATTGG + Intergenic
988873414 5:35416338-35416360 TTTGTATTACATGTCTTCAGAGG + Intergenic
988989189 5:36652671-36652693 TTAGTAATACATAGATATATTGG - Intronic
989063103 5:37430212-37430234 TTTTTATAAAATATCTTTATTGG + Intronic
989440102 5:41461105-41461127 TTGGTATTACATTGGTTTATTGG + Intronic
990095862 5:52111701-52111723 CTAGTATTTAATATTTTTATGGG + Intergenic
990903954 5:60783038-60783060 TTATAATTACATATATTTATGGG - Intronic
992278582 5:75148541-75148563 TTAGTAATAAACATTTTTATAGG - Intronic
992931264 5:81648720-81648742 ATAGTAGTATATATATTTATGGG + Intronic
993051219 5:82928317-82928339 TTACCATTACATATATGTATAGG + Intergenic
993251300 5:85527349-85527371 TTATTATTATATATGTATATAGG - Intergenic
993821938 5:92630978-92631000 TTATTATTGCATGTATTTATGGG + Intergenic
993896359 5:93539859-93539881 TTATAATTATATATGTTTATGGG - Intergenic
994672705 5:102781771-102781793 TTAGTATTAAAAATATTTCTGGG - Intronic
994710946 5:103263089-103263111 TTTGTAGTAGATTTCTTTATGGG + Intronic
996261779 5:121480157-121480179 ATGGTATTATATATATTTATGGG - Intergenic
996297123 5:121932893-121932915 ATAGTCTTAAATACCTTTATTGG - Intergenic
996422198 5:123274885-123274907 TTAGTATTAGCTATATTTAAAGG + Intergenic
996897997 5:128508607-128508629 TTAGTATTTTAAATCTTTTTAGG - Intronic
997060483 5:130495763-130495785 TTAGTGTAACATATGTTTAATGG + Intergenic
997527709 5:134564044-134564066 TTTGTATTACTTATTTTTCTAGG - Intronic
997676570 5:135717444-135717466 TTAGGATTCCATATCTTTTGGGG - Intergenic
998440519 5:142157706-142157728 TTAGCAGTCCATATTTTTATAGG + Intergenic
1000916836 5:167092982-167093004 TTAATATTCCATGACTTTATCGG + Intergenic
1001480182 5:172083380-172083402 TTTGTATTTTATATCTATATAGG - Intronic
1003895832 6:10606836-10606858 ATAGTTTTACATGTCTTTACTGG + Intronic
1005205321 6:23396418-23396440 TTTGTATTATATATATTTATGGG + Intergenic
1005224662 6:23627564-23627586 TTTGTGTTGCATATATTTATGGG + Intergenic
1005233292 6:23730107-23730129 TTTGTACTGCATATTTTTATGGG - Intergenic
1005423552 6:25677976-25677998 TTAGTTTTTCAAATCTTTGTAGG - Intronic
1006659701 6:35630228-35630250 TTACTATGACATATCATTACTGG + Intronic
1007169011 6:39849319-39849341 TTAGTTTTACATATTACTATAGG - Intronic
1007537507 6:42606567-42606589 TTAATTTTAAATATCTTTACAGG + Exonic
1008745503 6:54665056-54665078 TTAGTATTAGATACCTTGTTTGG + Intergenic
1008912737 6:56753251-56753273 TTAGCATGGCATATCTTTGTAGG - Intronic
1009003507 6:57750311-57750333 TTACTATAAGATATCTTCATTGG + Intergenic
1009763345 6:68037092-68037114 TTAGTTTTACAAATGTTAATAGG + Intergenic
1010600354 6:77817655-77817677 TTATAATTGCATATATTTATGGG + Intronic
1011772964 6:90695306-90695328 TTAGGGTTACATATCTTTCTAGG - Intergenic
1011867764 6:91851893-91851915 CTAGTAATACATATTTTTGTAGG - Intergenic
1012382739 6:98639797-98639819 TTAGTATTAAATAATTTTAGGGG - Intergenic
1012715174 6:102659980-102660002 TTATAATTACACATATTTATGGG - Intergenic
1012823090 6:104113340-104113362 TAATAATTACATATATTTATGGG - Intergenic
1012969250 6:105709361-105709383 TTAGTGATACATATCTTTTTTGG + Intergenic
1013610618 6:111791393-111791415 TTAGAACTTCATATCTTTTTGGG - Intronic
1014862560 6:126487487-126487509 TTATTATTGTATATGTTTATGGG + Intergenic
1014862891 6:126492033-126492055 TAATTATTATATATATTTATAGG + Intergenic
1015014344 6:128392816-128392838 TAAATATTACCTATCTATATTGG - Intronic
1015971616 6:138748306-138748328 CAAGCCTTACATATCTTTATAGG - Intergenic
1016112260 6:140239831-140239853 TTATTATTATTTATCTTTCTTGG + Intergenic
1016126844 6:140414092-140414114 TTAGTATTCACTGTCTTTATTGG - Intergenic
1016180071 6:141135032-141135054 CTTGTATTACATATTTTCATAGG + Intergenic
1016555569 6:145332831-145332853 TTAGTATTATGTGTTTTTATGGG + Intergenic
1017543546 6:155427399-155427421 TTAGTTTGACAAATATTTATTGG - Intronic
1018104779 6:160474436-160474458 TTAATATTATATAACTTCATGGG + Intergenic
1018167137 6:161108636-161108658 TCATGATTACATATATTTATGGG + Intronic
1018210744 6:161479346-161479368 TTATTATTACTTATCTTTCTAGG - Intronic
1019106683 6:169673593-169673615 TTTATAGTAGATATCTTTATGGG - Intronic
1020590245 7:10126616-10126638 TTTGTAGTGCATCTCTTTATAGG + Intergenic
1020892491 7:13896502-13896524 TTAATATTACATATCTGAAATGG + Intronic
1021173398 7:17421653-17421675 TTAGTATTACCAATCTTTTCAGG - Intergenic
1021592340 7:22277441-22277463 TTATTATTTCATATTTGTATAGG + Intronic
1022681570 7:32552376-32552398 TTAGAATTACATCTCTATATGGG + Intronic
1023006319 7:35872347-35872369 TAAGTATTACATGTCTTTAGTGG + Intronic
1024068016 7:45759437-45759459 TATGTATTACATGTCTTTAGTGG - Intergenic
1024662145 7:51507409-51507431 TATGTATTACATATATTTATAGG - Intergenic
1024707457 7:51975968-51975990 TTGCTACTAAATATCTTTATTGG - Intergenic
1027519279 7:79183311-79183333 ATATTTTTACATATGTTTATGGG - Intronic
1027689630 7:81327572-81327594 TTAGTATTATGTGTGTTTATAGG + Intergenic
1028798349 7:94930842-94930864 TTACTATTACATATTTTAAATGG - Intronic
1030316349 7:108118472-108118494 TCAGTAGGACATATTTTTATTGG - Intronic
1030947456 7:115741384-115741406 TTATAATTACATATATTTATAGG - Intergenic
1031164381 7:118211246-118211268 TTATAATTACATATATTTATGGG - Intergenic
1031906234 7:127462994-127463016 TAAGTATTCTATATCTTGATTGG + Intergenic
1032768005 7:135018935-135018957 GAAGTATTCCATATCTTGATAGG - Intronic
1033005171 7:137553568-137553590 TTAGTATTATTTATCCTTCTAGG + Intronic
1033382630 7:140838372-140838394 TTACTAATACAAATATTTATTGG - Intronic
1033681929 7:143603344-143603366 TTACTATCATATATCTCTATGGG - Intergenic
1033702961 7:143858569-143858591 TTACTATCATATATCTCTATGGG + Intronic
1034871458 7:154688403-154688425 TTACTCTTACATATCTTCTTTGG + Intronic
1035667035 8:1386993-1387015 TTAGTATTAAATTTATTTTTAGG - Intergenic
1037771600 8:21803987-21804009 TTAGTATTATTTATCTTCCTGGG - Intronic
1038989522 8:32852589-32852611 TTAGGTTTCCATCTCTTTATTGG + Intergenic
1039188254 8:34941940-34941962 TTATTTTTAAATATCTTTAAAGG - Intergenic
1039301392 8:36212811-36212833 TTATTATTACTTCTCTCTATGGG + Intergenic
1040453128 8:47568277-47568299 TTCGTAATACACTTCTTTATAGG + Intronic
1040466439 8:47699873-47699895 TAAGTAATACATATCTGTTTGGG + Intronic
1041506080 8:58599218-58599240 TGAATATTACATACCATTATGGG + Exonic
1042450637 8:68941276-68941298 TTATAATTACATATATTTATGGG - Intergenic
1043045070 8:75312918-75312940 TTAGTATTATTTATTTTTACAGG - Intergenic
1043451281 8:80369778-80369800 TTAGTATTTCATTTCTCTATTGG - Intergenic
1044239094 8:89867744-89867766 ATAGTAATAAATATTTTTATAGG - Intergenic
1044680152 8:94769368-94769390 TTAGTTTTATATATCTAAATAGG + Intronic
1045666519 8:104493371-104493393 TTAGAATAAAATATGTTTATGGG - Intronic
1046304788 8:112351507-112351529 TTAGTAAAACATATTGTTATAGG - Intronic
1046384547 8:113492073-113492095 TTAGTATTTCATTTCTTTTGTGG + Intergenic
1047691503 8:127359325-127359347 TTACTATTATCTACCTTTATAGG - Intergenic
1051014745 9:12461219-12461241 TTAGTTCTATATATTTTTATTGG + Intergenic
1051069138 9:13141695-13141717 CTAGTGTTACATATATTTTTAGG - Intronic
1052593937 9:30535343-30535365 TTAATATAACAGAGCTTTATAGG + Intergenic
1053935592 9:43146925-43146947 ACTCTATTACATATCTTTATTGG - Intergenic
1055442232 9:76347895-76347917 TTATAATTATATATATTTATAGG + Intronic
1055883094 9:81025740-81025762 TTATTATTACGTATCATTTTTGG - Intergenic
1056106328 9:83350286-83350308 TTAGTATTATCTATCTATAAAGG + Intronic
1057014018 9:91634521-91634543 TTAGTCTTTAATATGTTTATGGG - Intronic
1057366102 9:94422713-94422735 TACGTATAACATATATTTATTGG + Intronic
1057657230 9:96965352-96965374 TACGTATAACATATATTTATTGG - Intronic
1058622167 9:106895132-106895154 ATAATATTCCATACCTTTATTGG + Intronic
1059858106 9:118424235-118424257 TAAGTAATCCAGATCTTTATAGG + Intergenic
1187039826 X:15581812-15581834 TTATTATTGTATATATTTATGGG - Intronic
1187981361 X:24761185-24761207 TTTGTATTACCTGTTTTTATTGG + Intronic
1188215842 X:27476072-27476094 TTAGTATTACAGATGTGTGTGGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1189898320 X:45679663-45679685 TTTGTATTGAATATATTTATAGG - Intergenic
1190802172 X:53800040-53800062 TTAGAATTGTATATATTTATGGG - Intergenic
1191715027 X:64188297-64188319 TTCCTTTTACATGTCTTTATTGG - Exonic
1192403618 X:70861765-70861787 TAAGTATTAAATATCTCTCTGGG - Intronic
1193625110 X:83810000-83810022 TTATTTTTACATTACTTTATGGG - Intergenic
1193773076 X:85610712-85610734 GTAGTCTTACATAGATTTATTGG + Intergenic
1193837141 X:86357625-86357647 TTTGTATTAAATATTTTTCTGGG + Intronic
1194258406 X:91663500-91663522 TTAGTAATAAATATCTTTGGTGG + Intergenic
1194356739 X:92895265-92895287 GTAGAATTACAAATCTTGATAGG - Intergenic
1194812257 X:98400871-98400893 TTATTATTACATCAATTTATAGG + Intergenic
1195497822 X:105558263-105558285 ATAGTAGTACATATCTTTCAGGG + Intronic
1195607505 X:106824585-106824607 TTTGTATTTCATTTCTTTATTGG + Intronic
1195739880 X:108052739-108052761 TAATTATTGCATATATTTATGGG - Intronic
1195998253 X:110753221-110753243 TCAGTATGACATTTCTTTTTAGG - Intronic
1197724971 X:129770117-129770139 TTAGTAGTACCTGTCTTTGTGGG - Intergenic
1197979752 X:132203123-132203145 TTACTTTTACAAATCTTTATAGG + Exonic
1198003541 X:132466672-132466694 GTAGTATGCCATTTCTTTATGGG + Intronic
1198124817 X:133632516-133632538 TTAAAATTACATATGTTCATTGG - Intronic
1198148718 X:133886446-133886468 TTATAATTGCATATATTTATGGG + Intronic
1198459644 X:136850733-136850755 TTAGTTTTACAGTTGTTTATGGG + Intronic
1200327111 X:155252401-155252423 TTCTTATTACTTATTTTTATCGG - Intergenic
1200577174 Y:4902995-4903017 TTAGTAATAAATATCTTTGGTGG + Intergenic
1200665073 Y:6012265-6012287 GTAGAATTACAAATCTTGATAGG - Intergenic
1201243178 Y:11978408-11978430 TCAGTTTTACATTTCTTTAATGG + Intergenic
1201376633 Y:13330129-13330151 CTAGTGTTACAAACCTTTATTGG - Intronic
1201535233 Y:15040157-15040179 TGACTATCACATATCTTTTTAGG + Intergenic