ID: 901712508

View in Genome Browser
Species Human (GRCh38)
Location 1:11126746-11126768
Sequence CCGGCACATCAGAAGTTTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901712501_901712508 0 Left 901712501 1:11126723-11126745 CCTGGCACAGCCAATTCAAGGTC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 901712508 1:11126746-11126768 CCGGCACATCAGAAGTTTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 66
901712503_901712508 -10 Left 901712503 1:11126733-11126755 CCAATTCAAGGTCCCGGCACATC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 901712508 1:11126746-11126768 CCGGCACATCAGAAGTTTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901712508 Original CRISPR CCGGCACATCAGAAGTTTTG GGG Exonic
901475363 1:9485699-9485721 AGGGCAAATCAGAAGTGTTGAGG + Intergenic
901712508 1:11126746-11126768 CCGGCACATCAGAAGTTTTGGGG + Exonic
902499683 1:16901573-16901595 CTGTCAGAACAGAAGTTTTGGGG - Intronic
908233212 1:62126069-62126091 CCAGCATAGCAGAAGTTTAGAGG - Intronic
919864624 1:201771143-201771165 CCGGGTCACCAGATGTTTTGAGG - Intronic
1067424159 10:46190287-46190309 CCTGGACATCAGGATTTTTGGGG - Intergenic
1070860566 10:79655535-79655557 CCTGGACATCAGGATTTTTGGGG - Intergenic
1070876700 10:79820014-79820036 CCTGGACATCAGGATTTTTGGGG + Intergenic
1073205783 10:101768669-101768691 CCGGCAGATCAGGAATTTCGAGG - Intergenic
1073921594 10:108466089-108466111 CCCGCACAGCAGGAGTTGTGAGG - Intergenic
1080559470 11:33449713-33449735 CAGACACATCAGATGCTTTGTGG + Intergenic
1086539337 11:87889157-87889179 CAGGCACATCAGCAGTTTCCTGG - Intergenic
1093752610 12:22818084-22818106 CCAGCACCTCAGCAGTTTGGGGG - Intergenic
1095725271 12:45445565-45445587 CTGCCACATGACAAGTTTTGTGG + Intergenic
1096385216 12:51190773-51190795 CGGGCACATCAGAGGGTCTGAGG - Intronic
1100193084 12:92213780-92213802 GTTGCACATCAGAAGTTTTGTGG - Intergenic
1100382904 12:94078287-94078309 CCAGCTCTTCCGAAGTTTTGAGG + Intergenic
1101362654 12:104042404-104042426 CTGTCACATAAGAAGTTTGGAGG - Intronic
1107707122 13:43119272-43119294 CCGGACCATCAGACTTTTTGGGG + Intergenic
1117241876 14:53842132-53842154 CCATCACATCAGAACCTTTGAGG + Intergenic
1119541752 14:75443256-75443278 CCAGCACATCAGCTGGTTTGGGG - Intronic
1126465018 15:48954103-48954125 CCAACACATCAGAAGTGCTGAGG - Intronic
1129758650 15:78113941-78113963 CCTACACCTCTGAAGTTTTGTGG + Intronic
1146340621 17:32016590-32016612 CCTGCACATCAGAATTATTTGGG + Intronic
1148175719 17:45562624-45562646 CCTGCACATCAGAATTATTTGGG - Intergenic
1148295655 17:46500378-46500400 CCTGCACATCAGAATTATTTGGG + Intergenic
1149026065 17:52028817-52028839 TCGTCACAGCAGAAGCTTTGTGG - Intronic
1150406942 17:64909573-64909595 CCTGCACATCAGAATTATTTGGG - Intronic
1153678171 18:7474391-7474413 CTGGCACATAAGAATGTTTGGGG - Intergenic
1160593547 18:79958706-79958728 GCTGCACATCAGAACTTCTGGGG - Intergenic
1163430403 19:17263925-17263947 CAGGCACATCAGCAGATCTGTGG + Intronic
932096106 2:68850303-68850325 CTGGCACACCAGAAATTTGGAGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935370260 2:102338560-102338582 CCTGCACATGGGAAGTGTTGTGG + Intronic
939920351 2:148102873-148102895 CTGGCAGATCAAATGTTTTGTGG + Intronic
947707950 2:232291928-232291950 ACGCCACATCAGAGGTTTCGAGG - Intronic
1170140212 20:13118362-13118384 CCAGCAGATCAGAATTTTTAAGG - Intronic
1170998157 20:21385902-21385924 CTTGAACATCAGAAGCTTTGGGG - Intronic
1178916208 21:36706827-36706849 CCGGCAAAGCAGAGGCTTTGGGG + Intronic
951364019 3:21758504-21758526 GAGACACATCAGAAATTTTGTGG + Intronic
953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG + Intergenic
955863326 3:63355613-63355635 CCGGTGCATCAGAAGTTATAGGG - Intronic
959055267 3:101561640-101561662 CCGGCCCAGAAGAAGTTTTTAGG + Intergenic
973847431 4:54927338-54927360 CCTGGACATCAGAAATTTTAAGG - Intergenic
978659920 4:111113295-111113317 CCGTCACATAAGAAGTATGGAGG + Intergenic
979071651 4:116215234-116215256 CTGCCACATCAAAAGTTTTAAGG - Intergenic
982216281 4:153085196-153085218 CTGCCACCTTAGAAGTTTTGTGG + Intergenic
984765588 4:183398301-183398323 CCGGCACAGCAGAAACCTTGGGG + Intergenic
987614833 5:20260189-20260211 CCAGCATTTCAGAAGTGTTGGGG - Intronic
993610797 5:90051965-90051987 CCGGCACATCAGAATTTTCCAGG - Intergenic
1005909646 6:30297290-30297312 CCAGCACTTCAGGAGATTTGCGG - Intergenic
1007601397 6:43084002-43084024 CCTGCCCATCAGAATTATTGAGG + Intronic
1015308869 6:131742575-131742597 CAGGATAATCAGAAGTTTTGGGG - Intronic
1023553248 7:41391372-41391394 CAGGCAAAACAGAACTTTTGGGG - Intergenic
1030736971 7:113060565-113060587 CTGGAATATCAGAAGTTTTGTGG + Intergenic
1031464357 7:122090363-122090385 CAGGCAAATCAGAATCTTTGGGG + Intronic
1032491469 7:132327474-132327496 CTGCCACTTCAGAAGGTTTGTGG - Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054943067 9:70764965-70764987 CAGACACATCAAATGTTTTGTGG - Intronic
1055098526 9:72439454-72439476 CCTGCACATCACAAGTTAAGAGG + Intergenic
1057856703 9:98606439-98606461 CTGGCACATCAGAAGCACTGTGG + Intronic
1059891646 9:118811147-118811169 CCAGTGCATCAGAAGTTTTGGGG - Intergenic
1062227436 9:135460697-135460719 GCAGCAGGTCAGAAGTTTTGAGG - Intergenic
1190146981 X:47902753-47902775 TCGACACATCAGAACTTGTGGGG + Intronic
1191685529 X:63885512-63885534 CAGGCACAGCAGCAGGTTTGTGG - Intergenic