ID: 901718916

View in Genome Browser
Species Human (GRCh38)
Location 1:11179516-11179538
Sequence AAGCTGGCCAAAAGGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901718916_901718926 30 Left 901718916 1:11179516-11179538 CCCTCTGTCCTTTTGGCCAGCTT 0: 1
1: 0
2: 2
3: 21
4: 227
Right 901718926 1:11179569-11179591 ACAATTCCTCGCTGATGGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 49
901718916_901718925 25 Left 901718916 1:11179516-11179538 CCCTCTGTCCTTTTGGCCAGCTT 0: 1
1: 0
2: 2
3: 21
4: 227
Right 901718925 1:11179564-11179586 TTCTTACAATTCCTCGCTGATGG 0: 1
1: 0
2: 1
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901718916 Original CRISPR AAGCTGGCCAAAAGGACAGA GGG (reversed) Intronic
900346358 1:2212386-2212408 ACGCTGCCCCCAAGGACAGACGG + Intronic
901001200 1:6149584-6149606 AAGATGGATAAAAGGAAAGAAGG + Intronic
901718916 1:11179516-11179538 AAGCTGGCCAAAAGGACAGAGGG - Intronic
901815654 1:11791954-11791976 GAGTTGGCCAACAGGAGAGAAGG - Intronic
902613728 1:17612372-17612394 TAGCTGGGCAAATGGACAGATGG - Intronic
903040617 1:20527209-20527231 AAGCTGGCCTCAAGCACACATGG + Intergenic
903451502 1:23456649-23456671 ATGCTGAGCAAAAGGCCAGAGGG + Intronic
904230866 1:29070306-29070328 AAGATGAACAAAATGACAGATGG - Intronic
906270090 1:44470749-44470771 GAGAGAGCCAAAAGGACAGAAGG - Intronic
908690215 1:66771196-66771218 AAACTGGCTACAAGGCCAGAGGG - Intronic
910405157 1:86880959-86880981 AACCTAGCCAAAAAGACCGAAGG + Intronic
911039429 1:93579986-93580008 CATCTGGCCAAAAGTACAGCAGG + Intronic
913500930 1:119471968-119471990 CAGCTTGCCACAAGGACGGAGGG + Intergenic
914680922 1:149937698-149937720 AAGCTGGGAACAAGGAGAGAAGG + Intergenic
915135678 1:153729480-153729502 AAGCTGGGTAAGAGGACAGGAGG - Intronic
916106943 1:161440024-161440046 AGCCAGGCCAAAAGGACAGATGG + Intergenic
920406649 1:205718832-205718854 AAGCAGGTCAAAAAGACGGAAGG + Intronic
920671492 1:208006878-208006900 AAGCTGGAGGAAAGGACATAGGG - Intergenic
922753061 1:228080033-228080055 AAGGTGGCTGGAAGGACAGATGG - Intergenic
923779751 1:237011766-237011788 AAGTTGGCCAAAAGAAAAGTAGG - Intergenic
1063544820 10:6970684-6970706 CAACTGGCCAAAAGGAGAGCAGG + Intergenic
1063560340 10:7120456-7120478 ATGCTGGCCATGAGGAAAGATGG + Intergenic
1065591498 10:27266809-27266831 GATCTGCACAAAAGGACAGAAGG - Intergenic
1065659520 10:27991391-27991413 GATCTGCACAAAAGGACAGAAGG + Intronic
1065805840 10:29393145-29393167 AAGCTGAGCAAAAGGCCAGGTGG + Intergenic
1066288434 10:33991326-33991348 TAGATGGAGAAAAGGACAGATGG - Intergenic
1067181884 10:43993601-43993623 AAGATTGCCAAAATGATAGAAGG - Intergenic
1070353056 10:75611799-75611821 CATTTGGCCAAAAGGACAGGTGG - Intronic
1070559307 10:77553769-77553791 AAGGTAACCAAAAGGACAGAAGG + Intronic
1071503164 10:86217774-86217796 CAGCTGGCCCAAAGGCCAGCAGG - Intronic
1072583547 10:96761368-96761390 AAGGTGGGCAAAAGGACAGGAGG - Intergenic
1073724929 10:106219434-106219456 AAGATGGTCAAAAGTACTGAGGG + Intergenic
1074367876 10:112874651-112874673 ACAATGGCCAAAAGGAGAGAAGG - Intergenic
1075920244 10:126205352-126205374 AAGTTGGCCTAAAGTACACAGGG - Intronic
1077107142 11:847183-847205 AAGCTCTGCAAAAGGAAAGATGG - Exonic
1080103509 11:28486603-28486625 TAGATGGCCTAAAGGGCAGATGG - Intergenic
1080607519 11:33875955-33875977 ATGCTGGAGAAAAGGACAGGGGG - Intronic
1084561346 11:69907236-69907258 AAGGAGGCCAGAGGGACAGAAGG + Intergenic
1085264695 11:75230395-75230417 CAACTGGCTAAAAGGAAAGAGGG - Intergenic
1086148434 11:83580976-83580998 AAGATTGCCAAAATGAAAGAAGG - Intronic
1086374330 11:86184948-86184970 AAGCTGGAAAACAGGCCAGACGG - Intergenic
1086935301 11:92739107-92739129 AAGCTACATAAAAGGACAGATGG + Intronic
1090113687 11:123943342-123943364 AGGCTGGCCATGAGGACAGTGGG + Exonic
1091443190 12:527469-527491 AAGCTGGGGGAAAGGACAGCTGG + Intronic
1091635248 12:2192230-2192252 AACCTGGCAAAAAGGCCTGAGGG - Intronic
1093726935 12:22524042-22524064 AAAGTGGTCAAAAGGATAGAGGG + Intronic
1095628119 12:44342309-44342331 AAGCTGGCTAAAAAGAGGGAGGG - Intronic
1097769283 12:63562781-63562803 AAAAAGGACAAAAGGACAGATGG - Intronic
1098091775 12:66910197-66910219 AAACTGGCCAGAAAGACAGAAGG - Intergenic
1100259947 12:92923523-92923545 AAGGAGGGAAAAAGGACAGAAGG - Intronic
1102517217 12:113457796-113457818 AAGCTAGCCAGAAGAGCAGAGGG - Intergenic
1102541154 12:113620079-113620101 TAGCTTGCCAACATGACAGAGGG + Intergenic
1102905777 12:116674221-116674243 AAGCTGGCCAGAAAACCAGAAGG - Intergenic
1103908480 12:124339432-124339454 TAGATGGGCAAAAGGATAGATGG - Intronic
1105550809 13:21394153-21394175 GAGGGGGCCAAAATGACAGAGGG - Intronic
1106787340 13:33120683-33120705 AAGATGGCCAAAGGGAAAGATGG + Intronic
1107142490 13:37016627-37016649 AAACTGGGCAAAAGGACTAATGG + Intronic
1108453832 13:50594212-50594234 AAGATTGCCAAAATGTCAGATGG - Intronic
1109362792 13:61318360-61318382 AACCTGACAAAAATGACAGAGGG + Intergenic
1113006382 13:105707183-105707205 AAGCTTAAGAAAAGGACAGAAGG + Intergenic
1114528712 14:23381952-23381974 CAGCTGGCAGGAAGGACAGATGG + Intergenic
1114638315 14:24201535-24201557 AAACTGGCCAAAGGGGCAGAAGG - Intronic
1114675261 14:24436082-24436104 AAGCTGGCTGAAGAGACAGATGG + Exonic
1117097028 14:52309465-52309487 ATTCTGGCTAAAAAGACAGAGGG + Intergenic
1117525581 14:56599227-56599249 CAGGAGGGCAAAAGGACAGAAGG - Intronic
1118910909 14:70061199-70061221 AAGGGAGCCAGAAGGACAGAAGG + Intronic
1119313032 14:73666869-73666891 AAAGTGGCCAAAAAGACAGGAGG - Intronic
1120330740 14:83090322-83090344 CAGCAGGTCTAAAGGACAGAGGG + Intergenic
1121472390 14:94165648-94165670 AAGCTGGTCAGAAGCACAGGTGG - Intronic
1121924310 14:97914145-97914167 GAGCTTGACCAAAGGACAGAGGG - Intergenic
1126113454 15:45188261-45188283 GAGCTGGGGAAAAGAACAGATGG - Intronic
1127546174 15:59995962-59995984 TCGCTTCCCAAAAGGACAGAGGG - Intergenic
1128333946 15:66774146-66774168 AGTCTGGCCAAAAGGAAAGCGGG + Intronic
1129509351 15:76109221-76109243 AAGCTGTCCAAAGGGTCAGGTGG + Intronic
1131545319 15:93311017-93311039 ATCCTGGACAAAAGGAAAGATGG - Intergenic
1131804230 15:96105067-96105089 AAACTGGTCACAAGTACAGAAGG - Intergenic
1132240776 15:100255717-100255739 AAGCTGGGCAAAGGGAGAAAGGG + Intronic
1132654111 16:1034716-1034738 CAGATGGACAAATGGACAGAGGG - Intergenic
1133119003 16:3594994-3595016 GACCTGGCCAAGAGGACAGCCGG + Intronic
1135221060 16:20614359-20614381 AGGCTGGCCAAGAGGACACCTGG + Intronic
1139927255 16:70496470-70496492 AACTTGGCCACCAGGACAGAAGG + Intronic
1140989349 16:80193538-80193560 AAGCAGGCCATAAGGACAGCAGG - Intergenic
1141756241 16:85992969-85992991 AAGAAGGACAGAAGGACAGAAGG - Intergenic
1143452809 17:7046162-7046184 AGGCTGGCAAAAGGGAGAGAGGG - Intergenic
1144887178 17:18471286-18471308 AGCCTGGCCAAAGGGAGAGATGG + Intergenic
1145145038 17:20473009-20473031 AGCCTGGCCAAAGGGAGAGATGG - Intergenic
1148019218 17:44542390-44542412 ACACCAGCCAAAAGGACAGATGG - Intergenic
1150512784 17:65774476-65774498 AAGCTGGCCAACAAGACTGCAGG + Intronic
1151697884 17:75727384-75727406 CATCTGGCCAGAAGGACAGGGGG - Exonic
1152746154 17:82040248-82040270 AAGCTGGGCAAGAGGGCAGAGGG - Intergenic
1153917870 18:9761747-9761769 AAGCAGGCAAAAGGGAGAGAGGG + Intronic
1155372039 18:25111995-25112017 AAGCTTCCCTAAAGGACAAAGGG + Intronic
1155451506 18:25968672-25968694 AAGCTGAGTAAAAGGACAGTGGG - Intergenic
1156598817 18:38579701-38579723 AAGCTTCCCAGAAGAACAGAAGG + Intergenic
1158218496 18:55125897-55125919 ACACTGGCCAAAAGGACAGATGG - Intergenic
1158324807 18:56302466-56302488 AACCAGGCCACAAGGAGAGAGGG - Intergenic
1160005771 18:75068076-75068098 AAGATGGCTAAAAGGACGCACGG + Intergenic
1161762749 19:6186602-6186624 CAGTTGGCCAAAAGGTCAGCTGG + Intronic
1162180896 19:8867962-8867984 TAGATGGATAAAAGGACAGATGG + Intronic
1164661610 19:29976433-29976455 AAGCTGGACAAAAGAGCACATGG - Intronic
1164849856 19:31472484-31472506 AAGCAGGCTTACAGGACAGAAGG + Intergenic
1166878076 19:45910155-45910177 AAGAAGGCAAAAACGACAGATGG + Intergenic
925887249 2:8403546-8403568 AAGCTGGCCAAAAGAAGAAAAGG + Intergenic
927388528 2:22564886-22564908 AAGCAGGCAGAAAGGAAAGATGG + Intergenic
928762917 2:34605825-34605847 AAGTGGGGCAGAAGGACAGAAGG + Intergenic
929776529 2:44934060-44934082 GGGCTGGGCAAAAGGAGAGAGGG + Intergenic
930302166 2:49630196-49630218 AAGAAGGGCAAAAAGACAGATGG + Intergenic
934715251 2:96539283-96539305 AAGTGGGCCAAGAGGACAGATGG - Intronic
934898331 2:98138271-98138293 AAGCAGCCTAAAAGGGCAGACGG - Intronic
936530816 2:113276212-113276234 AAGCTGATCAGAAAGACAGACGG + Intronic
937275855 2:120683698-120683720 AAGCTGGAAGCAAGGACAGATGG - Intergenic
939167089 2:138651813-138651835 AAGGTGGCCGAAGGGACTGAAGG + Intergenic
940079584 2:149785261-149785283 AGGCAGGTCAAAGGGACAGAAGG - Intergenic
941086829 2:161127672-161127694 GAGATGGCCAAAAAGAGAGATGG - Intergenic
942191362 2:173473695-173473717 AACATGCCCAAAAGGAAAGAAGG - Intergenic
944744267 2:202639515-202639537 AAGTTGGGTAAAAGGAGAGAAGG - Intronic
944970340 2:204985560-204985582 AATTTGACCAAATGGACAGAGGG + Intronic
946630148 2:221658318-221658340 AAGATGGCCAAAAGCCTAGAAGG - Intergenic
947010269 2:225558368-225558390 AAGCTGGAAAAATGGACAAAGGG - Intronic
947150241 2:227108097-227108119 ATGTCGGCCAAAAGGACAGTGGG + Intronic
948053207 2:234993338-234993360 AAGCCGTCATAAAGGACAGATGG - Intronic
948430871 2:237918025-237918047 AAGATGTGCAAAAGGACAGGAGG + Intergenic
948545987 2:238729250-238729272 AAGCAAGCCAGTAGGACAGAGGG + Intergenic
1170575677 20:17659807-17659829 AACCAGGGCAAAAAGACAGAGGG - Intronic
1171146670 20:22790137-22790159 AAGCTTGCCCAAAGGATACAGGG + Intergenic
1171720515 20:28558129-28558151 AAACTGGACAAAAGGCCACAAGG + Intergenic
1171958583 20:31477355-31477377 GGACTGGCCAAAAGGACATAGGG + Intronic
1172099520 20:32476793-32476815 AAGCAGGGCAAGAGGGCAGAGGG + Intronic
1172912241 20:38418592-38418614 AAGCTGGAGAAAAGGATACAAGG - Intergenic
1172946025 20:38690199-38690221 AAGCTATCCATAAGGACAGAGGG + Intergenic
1175746964 20:61463810-61463832 GAGCTGGCAGAAAGGACAGGAGG + Intronic
1175971621 20:62689446-62689468 CAGCTGCCCGAACGGACAGACGG + Intergenic
1176257450 20:64159678-64159700 AAGCTGGCCCAGAGGACAGCCGG + Intronic
1179127655 21:38605029-38605051 AAGCTGGAAGAGAGGACAGATGG - Intronic
1179560785 21:42214900-42214922 GAGCTGGGCAAAGGGGCAGAGGG + Intronic
1180839215 22:18951051-18951073 ATGCTGGGCACAAGGACTGACGG - Intergenic
1181638795 22:24186328-24186350 AGGCTGGCCAACAGGACCGGAGG + Exonic
1182082764 22:27541001-27541023 GAGCTGGCCAGAAGGTCAGAGGG - Intergenic
1182241184 22:28917691-28917713 AAAAAGGCCAAAAGGACATAGGG + Intronic
1182818430 22:33189942-33189964 AAGTTGTCCAAAGGGACAAAGGG + Intronic
1183649660 22:39146530-39146552 GAACTGGCCAAAAGGCCAGCAGG + Intronic
1185002475 22:48254286-48254308 AGGCTGGCCAGAAGGAGTGAGGG + Intergenic
1185385121 22:50528307-50528329 AAGTTGGTCAAAATCACAGATGG - Intronic
949184046 3:1169031-1169053 AAGCAGGCCAGAATGACTGATGG + Intronic
951781535 3:26368698-26368720 AAACTGCCCGAAAGGATAGAAGG - Intergenic
951857610 3:27215039-27215061 AAGCCGGCCAAGAGGAAAGCTGG - Intronic
956166362 3:66400913-66400935 AAGCTGGCCACACGGACTGGTGG - Intronic
956458098 3:69443518-69443540 AAGTTGGTCAAAAGTGCAGAGGG + Intronic
958801024 3:98756044-98756066 AAGCTGGAAAAGAAGACAGATGG + Intronic
960172375 3:114477393-114477415 AATGTGCCCAAAAGGACACAGGG + Intronic
961361087 3:126367550-126367572 AAGCTGCCCAAAAGGAACCAAGG + Intergenic
963107137 3:141657136-141657158 AAGCATGCCAAACGGAAAGACGG - Intergenic
963817499 3:149848345-149848367 ATGCTGTCCATAAGGATAGAAGG + Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
967201333 3:187075038-187075060 TAGCTGGGCAAAGGGACAGCTGG - Intronic
968360228 3:198141565-198141587 AAGCAGGCCAAAACCACAGGGGG - Intergenic
969021200 4:4141656-4141678 ATGCTGGGCAAAAGGGCAGCGGG - Intergenic
969502521 4:7561775-7561797 CAGATGGGCAAATGGACAGATGG - Intronic
970612213 4:17736445-17736467 AAACTCTCCAAAAGTACAGAGGG + Intronic
970960945 4:21870620-21870642 AAGCTGCTCAAAGGGAGAGATGG - Intronic
971362381 4:25950102-25950124 ATGCGGCCCAAAAGGATAGATGG + Intergenic
971598319 4:28560222-28560244 AAGCTGGGGAAGGGGACAGAAGG + Intergenic
971805405 4:31351928-31351950 CAGCTGTCCAAAATGACAGCAGG - Intergenic
975871856 4:78787792-78787814 AGCCTGGCCCAAAGGTCAGAGGG + Intronic
977059321 4:92237706-92237728 AAACAGGCCAAAAGAACAGCTGG + Intergenic
977483066 4:97603823-97603845 AAGCTGGCTGAAGGGAGAGATGG + Intronic
980801566 4:137757529-137757551 AAATTGTCCAAAAGTACAGAGGG - Intergenic
982742290 4:159070090-159070112 CAGATGGGGAAAAGGACAGATGG + Intergenic
982844731 4:160235914-160235936 TTTTTGGCCAAAAGGACAGATGG - Intergenic
984310564 4:178052896-178052918 GTGATGGCCACAAGGACAGACGG - Intergenic
984585056 4:181553939-181553961 GAGCTGGCAGAGAGGACAGAAGG - Intergenic
985872162 5:2565484-2565506 AAGCTGGGGAAAGGGACACAAGG - Intergenic
986517801 5:8581661-8581683 AACCTGGGCAAAGGGGCAGATGG - Intergenic
987088609 5:14491197-14491219 TAGCTGGCCAAAAGGACCAGAGG - Intronic
990681802 5:58253224-58253246 AGGATGGGCAAGAGGACAGAGGG + Intergenic
992569325 5:78038721-78038743 AAGCTGACCAGGAGGAGAGATGG + Intronic
992804129 5:80320204-80320226 GAGCTGGCCATCAGGACAGAAGG - Exonic
996883815 5:128331841-128331863 TAGTTGGCCAAAATGACAGATGG + Intronic
1000277361 5:159750247-159750269 AAACTGGCCTAAAAGACAAAAGG + Intergenic
1001649543 5:173305673-173305695 AAACTGCCTAAAAAGACAGAGGG + Intergenic
1004808800 6:19236215-19236237 AAAATGACCAAAAAGACAGAAGG + Intergenic
1006234290 6:32614857-32614879 AAGCAAGCCAATAGGACAGCAGG + Intergenic
1006674910 6:35755696-35755718 CAGCTGGAAAAAAAGACAGAGGG - Intergenic
1007337212 6:41162422-41162444 AACCTGGGCAAGAGGAGAGACGG - Intronic
1009269233 6:61597696-61597718 AAGCTTTCCAAAAGGACTAATGG + Intergenic
1009533985 6:64857277-64857299 AGGTTGGGCAAAAGGAGAGAGGG - Intronic
1009851306 6:69202733-69202755 AAGCTGGGTATAAGAACAGAGGG + Intronic
1011016482 6:82761480-82761502 AAGTTCGTCAAAAGGATAGAAGG + Intergenic
1012198597 6:96376808-96376830 AAGCTGCCCAACAGCAGAGAGGG - Intergenic
1012628815 6:101437696-101437718 AAGCTGGCAAGCTGGACAGATGG - Intronic
1013624274 6:111921166-111921188 AGGATGAACAAAAGGACAGATGG - Intergenic
1014432113 6:121383103-121383125 AAGCCGGTTAAGAGGACAGAAGG - Intergenic
1014806761 6:125838729-125838751 AAGGTGGACAAAAGTACAGGTGG - Intronic
1016317595 6:142807803-142807825 AAGCTGCCATAAAGAACAGAAGG + Intronic
1017230709 6:152070310-152070332 ATGCTGGGAACAAGGACAGAGGG - Intronic
1019167604 6:170108884-170108906 AAGCTGGGCCAACAGACAGACGG - Intergenic
1019259768 7:75066-75088 AAGCAGGCCAAAACCACAGGGGG + Intergenic
1020428370 7:8094909-8094931 CAGCTGACCAAAATCACAGATGG - Intergenic
1021487989 7:21187895-21187917 ACGTTGGCCAAAAGGACATGAGG + Intergenic
1021575217 7:22100223-22100245 CAGCTGGCCAGAGGGAGAGATGG + Intergenic
1023142493 7:37116000-37116022 AAGTTGAGCAAAAGTACAGAGGG - Intronic
1027125839 7:75556175-75556197 AAGGTGACCACAAGGAAAGAGGG + Intronic
1027329681 7:77078538-77078560 TAGCTTGTCTAAAGGACAGAGGG - Intergenic
1027864995 7:83634076-83634098 TAGCTGACTAAAAGGACAAATGG + Intronic
1029786081 7:102792800-102792822 TAGCTTGTCTAAAGGACAGAGGG + Intronic
1031896341 7:127352850-127352872 AAGGTGGACAGCAGGACAGAGGG - Intronic
1033506727 7:142010456-142010478 ATACTGGCCAAAGGGATAGAAGG - Intronic
1033539258 7:142340863-142340885 AAGCTGGCAAAGAAGAGAGAAGG - Intergenic
1036207612 8:6816466-6816488 CAGCTGGTCAAAATGGCAGATGG + Intronic
1036830107 8:12014577-12014599 TGGCTGGCCAAAAGGAGAGGGGG - Intronic
1036899190 8:12658869-12658891 CAGCTGGCCAAAAGGGGAGGGGG - Intergenic
1037880256 8:22570194-22570216 GAGCTGGCCCCAGGGACAGAGGG + Intronic
1038343339 8:26708201-26708223 AAGCAGGCAAAAATGAGAGATGG - Intergenic
1039010707 8:33089920-33089942 AAGCTAGCCAGAACGACAGAAGG + Intergenic
1039329067 8:36516373-36516395 AAGCTGTCCACTAGGACAGGAGG + Intergenic
1039824694 8:41163256-41163278 AAGCTGCCAGAAAGGACAGGTGG + Intergenic
1040296034 8:46149571-46149593 ATGCTGGCAATAAGGACACAGGG - Intergenic
1042302089 8:67294999-67295021 GAGCTGGTCACAAGGACACAGGG + Intronic
1042918384 8:73897494-73897516 CAGTTGGTCAAAAGGACAGGAGG + Intergenic
1043211690 8:77527379-77527401 GAGCTGGTGAAAAGGACAGTGGG - Intergenic
1043681848 8:83037835-83037857 AAGATGGCAGAATGGACAGATGG + Intergenic
1043912695 8:85881288-85881310 ATGCTAGGCCAAAGGACAGAAGG + Intergenic
1044277702 8:90321690-90321712 GACCTTGCCAAAAAGACAGAGGG + Intergenic
1047695470 8:127399411-127399433 CAGCTAGCCAAAAGGGCAAAGGG - Intergenic
1051918774 9:22238890-22238912 AAGCAGGCCAAAGAGACTGAAGG - Intergenic
1052980054 9:34441551-34441573 AAGCAGACCTAAAGGAGAGAGGG + Intronic
1057083353 9:92188794-92188816 GACCTGGCCAAAATGACTGAGGG + Intergenic
1057361584 9:94378280-94378302 AAGCTTGCAATCAGGACAGAAGG + Intronic
1057661774 9:97009890-97009912 AAGCTTGCAATCAGGACAGAAGG - Intronic
1058768937 9:108211636-108211658 GTGCTGGCCAAAATGACAGGGGG + Intergenic
1059701495 9:116779305-116779327 CACCTGGCAAAAGGGACAGAAGG - Intronic
1060300116 9:122370088-122370110 GAGCTGGCGAAAAGGAGAGCTGG + Intergenic
1060445879 9:123687606-123687628 GAGCTGGCAACAAAGACAGACGG + Intronic
1060951743 9:127608420-127608442 AGGCTGGCGATCAGGACAGATGG - Intergenic
1061453702 9:130682279-130682301 AAGCTGGCCTAAAGGAGAGAAGG - Exonic
1062010815 9:134265743-134265765 CACCAGGCCAGAAGGACAGACGG + Intergenic
1062098707 9:134716688-134716710 AAGCTGGCCACAGGGACTGAAGG - Intronic
1062479637 9:136745348-136745370 ATGCTGGCCACAGGGACAGAGGG + Intronic
1062744929 9:138205393-138205415 AAGCAGGCCAAAACCACAGGGGG - Intergenic
1185644208 X:1605556-1605578 AAGCTGGGCGAGAGGAGAGAAGG - Intergenic
1185681066 X:1888612-1888634 AAGCTGGATATAAAGACAGAAGG - Intergenic
1186528183 X:10268752-10268774 CATGTGGCCAAAGGGACAGAAGG - Intergenic
1186846166 X:13533199-13533221 AGGCTGGCAAACAGGCCAGATGG - Intergenic
1188301611 X:28511111-28511133 AAACTAGCCAAAAAGAAAGAGGG + Intergenic
1189582383 X:42420497-42420519 AAGCTGGCCCTAAGGCCAGAAGG - Intergenic
1190480247 X:50870241-50870263 AAGCTGGCAGAAGGGAAAGAGGG + Intergenic
1191915962 X:66201406-66201428 AGGGAGGACAAAAGGACAGAAGG - Intronic
1192314076 X:70038560-70038582 AAGCTGGCACAAAAGACAGCTGG + Exonic
1193183610 X:78486766-78486788 TAGCTTGTCACAAGGACAGAGGG + Intergenic
1194828986 X:98597186-98597208 CAGCTGGAAAAAAGGGCAGAGGG + Intergenic
1195012306 X:100744627-100744649 AAGCAGCCCAAAAGGATAGAGGG - Intergenic