ID: 901724399

View in Genome Browser
Species Human (GRCh38)
Location 1:11229459-11229481
Sequence GAACTAAACAGATGAAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901724399 Original CRISPR GAACTAAACAGATGAAGAGC TGG Intronic
900739851 1:4324153-4324175 GAAATGAACAGAAGAAGTGCAGG + Intergenic
900899918 1:5509387-5509409 GGGCTTCACAGATGAAGAGCAGG - Intergenic
901724399 1:11229459-11229481 GAACTAAACAGATGAAGAGCTGG + Intronic
901745602 1:11371247-11371269 AAAGGAAACAGATGAAGAGTGGG + Intergenic
902407167 1:16191019-16191041 CAAGTAAACAGGTGAAGTGCAGG - Intergenic
906484028 1:46220843-46220865 GGAGTTAACAGATGAAGAGATGG + Exonic
907571747 1:55490322-55490344 GGACTCAAAAGATGAAGAGGTGG - Intergenic
908984436 1:69999876-69999898 GAACTTTACAGAAGAAGACCTGG - Intronic
909618043 1:77634846-77634868 AAACTAAACAGAAGAGGAGTCGG - Intronic
909776291 1:79489290-79489312 AAACTAAACAGAATAAGAGAAGG + Intergenic
909787882 1:79639440-79639462 AAACTAAACAGAATAAGAGAAGG + Intergenic
909921585 1:81387923-81387945 GAACTAAAAAGATGGAAAGAAGG - Intronic
911178195 1:94838421-94838443 GAACTCAAAAGATCAAGAGTGGG - Intronic
912296843 1:108477936-108477958 AAACTAAACAGAATAAGAGAAGG - Intergenic
912484016 1:110009686-110009708 GAACTAAAAAGAAACAGAGCTGG - Intronic
914856240 1:151353000-151353022 GAAAGAAACAAATGAACAGCTGG + Intergenic
915137991 1:153747244-153747266 GGGAAAAACAGATGAAGAGCAGG - Intronic
915226772 1:154417501-154417523 GAAATAAAGAGATTAAAAGCAGG - Intronic
915958089 1:160240017-160240039 GGACTCATCAGATGATGAGCGGG - Exonic
916677433 1:167075683-167075705 GACCTTAACTGATGGAGAGCCGG - Intronic
916887420 1:169083429-169083451 GAACTATTCAGTAGAAGAGCTGG - Intergenic
921235904 1:213129693-213129715 GAGCAAAACAGAAGAAGAACGGG + Exonic
922935279 1:229417923-229417945 AAACTAAACAGAATAAGAGAAGG - Intergenic
923181435 1:231523716-231523738 GAACTGAATATATGAAGTGCAGG + Intergenic
923404600 1:233647539-233647561 GGACTGAACAGACGATGAGCAGG - Intronic
924181083 1:241439185-241439207 AAACTAAACAGAATAAGAGAAGG - Intergenic
924895728 1:248336392-248336414 AAACTAAACAGAGTAAGAGAAGG + Intergenic
924897725 1:248360875-248360897 GCAGTAAACAGAGGAATAGCAGG + Intergenic
924948420 1:248861447-248861469 GGAGCAAACAGATGAACAGCTGG - Intergenic
1063650139 10:7927453-7927475 GAACAAAAGAGAGGCAGAGCTGG - Intronic
1064664817 10:17639874-17639896 GACCTAAATAGAGTAAGAGCAGG + Intergenic
1069483982 10:68809179-68809201 AAATAAAACAAATGAAGAGCCGG - Intergenic
1069630076 10:69892244-69892266 GAGACAGACAGATGAAGAGCAGG - Intronic
1070743458 10:78917870-78917892 GAACTAAGCAGATGAGGAATGGG - Intergenic
1071023457 10:81084242-81084264 GAACTATCCAGTTGAAGAGCTGG + Intergenic
1071810611 10:89176959-89176981 GTACAAAACAGGTGGAGAGCTGG - Intergenic
1073965819 10:108988469-108988491 GAACTAAATGGAGAAAGAGCTGG + Intergenic
1074165997 10:110874143-110874165 CAACTAAACAGATTCAGAGAGGG - Intronic
1076557657 10:131338711-131338733 AAACTAATCAGATACAGAGCAGG - Intergenic
1080810022 11:35694541-35694563 GAACAAAACAAATGAAAAGGGGG - Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1084062538 11:66685676-66685698 GAATTAAACAGCAGAAGAGAAGG + Exonic
1084962702 11:72725667-72725689 GAACAAATCAGAGGGAGAGCAGG - Intronic
1087839118 11:102904594-102904616 AAACTAAACAGAATAAGAGAAGG + Intergenic
1088455834 11:110032122-110032144 GAAAAAAACAGGTGAAGTGCAGG - Intergenic
1089834201 11:121355799-121355821 AAAGGAAACAGATGAAGAGATGG - Intergenic
1090088182 11:123669866-123669888 GAACTCCACAAAAGAAGAGCTGG + Intergenic
1091217880 11:133914610-133914632 GAGCTAAACAGGTGGACAGCAGG - Intronic
1091491326 12:935277-935299 AAATGAAACAAATGAAGAGCAGG + Intronic
1092592265 12:9963119-9963141 AAACTAAACAGAATAAGAGAAGG + Intronic
1092963168 12:13615642-13615664 GAATAAAACAGACGAGGAGCCGG - Exonic
1093287819 12:17287120-17287142 AAACTATCCAGATGAACAGCAGG - Intergenic
1093482125 12:19614969-19614991 GAACCAAAGTGATAAAGAGCTGG + Intronic
1093812407 12:23506566-23506588 AAACTAAACAGAATAAGAGAAGG + Intergenic
1093834519 12:23810916-23810938 GAACTAAAGATAAGAAGAGAGGG - Intronic
1093951571 12:25168809-25168831 AAACTAAACAGAATAAGAGAAGG - Intronic
1094417794 12:30235751-30235773 GAAAGACGCAGATGAAGAGCAGG - Intergenic
1095504605 12:42881534-42881556 GAAGAAAATAGATGAAGAGATGG - Intergenic
1095742242 12:45620232-45620254 GAAATGAAGACATGAAGAGCTGG - Intergenic
1097229465 12:57500778-57500800 GATCTAAACAAATGTAGATCAGG - Intronic
1098472282 12:70859159-70859181 GAAATAAACAGATGAATGACTGG + Intronic
1099020396 12:77396361-77396383 GAAATAAACATATGAATAGATGG + Intergenic
1100459297 12:94783185-94783207 GTAATAAACAGATGAGGGGCCGG + Intergenic
1100658321 12:96670606-96670628 GGAACAAACAGAGGAAGAGCAGG + Intronic
1100665981 12:96753805-96753827 ACATCAAACAGATGAAGAGCAGG - Exonic
1108813814 13:54266795-54266817 AAACTAAACATATGAAGGGGTGG + Intergenic
1109499734 13:63218421-63218443 AAACTAAACGGATTAAGAGAAGG - Intergenic
1110567014 13:76967303-76967325 GAACTGAACAGAGGATGAGATGG - Intergenic
1110695820 13:78487251-78487273 GAAGTGAAGAGATGAAGAGAAGG - Intergenic
1111275977 13:85947456-85947478 GAACTAAAAAGATACAGAGATGG - Intergenic
1112741420 13:102477593-102477615 AAACTCAACAAATGAAGAGTTGG + Intergenic
1112888892 13:104208272-104208294 AAACTAAACAGAGTAAGAGAAGG + Intergenic
1113068020 13:106391396-106391418 GATCTACACAGTTGATGAGCTGG + Intergenic
1113196560 13:107814769-107814791 GAACTAAGCAGAAGATGAACAGG + Intronic
1113722346 13:112568724-112568746 GAACTATAAGGATGAAGAGCTGG + Intronic
1114416441 14:22547969-22547991 GAAAAAAGCAGATGAAGAGAAGG + Intergenic
1115422117 14:33207177-33207199 GAACAATACAGATTAAGATCTGG + Intronic
1115679819 14:35724991-35725013 TAAATAAATAGATGAATAGCTGG - Intronic
1115759280 14:36561769-36561791 GAGCTAAAGAGATCAAGATCAGG + Intergenic
1115968644 14:38921199-38921221 GAACTAAATTGATGAACAGCAGG + Intergenic
1116679631 14:47949446-47949468 GTAATAAACACATGAAGAGTTGG - Intergenic
1118479032 14:66144802-66144824 GAACTAGACAGAGGATGAGATGG + Intergenic
1119626503 14:76181426-76181448 GAAACAAACAGATAACGAGCAGG - Intronic
1120457056 14:84744990-84745012 GATCTAAACAGATCAATTGCAGG + Intergenic
1120597165 14:86454902-86454924 GAAGAAAAAAGATCAAGAGCTGG + Intergenic
1120754098 14:88225858-88225880 GAACTAAACATCTGAAAAGCAGG + Intronic
1120821830 14:88918600-88918622 GAACAGAACAGATGAAATGCTGG - Intergenic
1122504449 14:102222675-102222697 GAATTAAATAGATGAAGTGGAGG + Intronic
1124641220 15:31397787-31397809 GAACTACACAGATGAGGACGTGG + Intronic
1129302715 15:74635205-74635227 CAACTACTCACATGAAGAGCTGG - Intronic
1130787908 15:87120658-87120680 GTAATAAACACATGAAGATCTGG + Intergenic
1131062299 15:89411466-89411488 GAACTGAACAGATGGAGCGTGGG - Intergenic
1131448160 15:92516721-92516743 AAACTAAACAGAATAAGAGAAGG - Intergenic
1131578207 15:93613529-93613551 GAACTAAACAGATGGAAAAAGGG + Intergenic
1132121011 15:99175458-99175480 GAAGTAAAGAGATGAATAGAAGG + Intronic
1133256740 16:4521733-4521755 GAATTAAGCTGATGCAGAGCGGG - Intronic
1133564168 16:6977633-6977655 GAGCTAAAGAGATGACCAGCCGG - Intronic
1133651777 16:7819694-7819716 AAACTAAACGGATTAAGAGAAGG - Intergenic
1134285611 16:12859703-12859725 GAATTAGAAAAATGAAGAGCTGG - Intergenic
1135409423 16:22222106-22222128 GAAATAAGCAGCTGTAGAGCTGG - Intronic
1136507146 16:30711953-30711975 GAGCCAAGCAGATGAAGAGGAGG + Exonic
1140621087 16:76733919-76733941 GAACAAAAAAGATGGATAGCTGG - Intergenic
1141393111 16:83681082-83681104 GAACCAAGCAGAAGATGAGCAGG + Intronic
1141937566 16:87251748-87251770 GAAATAACCAGGTGAGGAGCAGG + Intronic
1143180668 17:4982205-4982227 GGACTGAACAGAGGAAGAGTTGG - Intronic
1143560363 17:7690309-7690331 GGACAAGACAGATGAAGGGCTGG + Intronic
1144094200 17:11884908-11884930 AAAAAAAACAGATGAAGAGGTGG - Intronic
1146025717 17:29319156-29319178 GAACAAAACAGATGGGGGGCTGG + Intergenic
1146781356 17:35676001-35676023 GAACAAAACAGAGGAGGAGGAGG - Intronic
1148584877 17:48770312-48770334 AAAATAAACAGATTAAGAGCTGG + Intronic
1149263264 17:54901171-54901193 GAACCAAACAGGTGAACCGCGGG + Intronic
1149503342 17:57172096-57172118 GAAATCAGCAGAGGAAGAGCGGG - Intergenic
1151522176 17:74638105-74638127 AAAGTAAACATGTGAAGAGCGGG - Intergenic
1151912155 17:77090691-77090713 AAGCTAAAAAGGTGAAGAGCTGG + Intronic
1152331113 17:79673776-79673798 CAACAAAACAGAAGAAGAACAGG + Intergenic
1152532783 17:80930033-80930055 GAACTGAACTGAGGATGAGCTGG - Intronic
1155213534 18:23622379-23622401 GAACAAAACAGACCCAGAGCAGG - Intronic
1156237902 18:35221811-35221833 AAACTAAACAGAATAAGAGAAGG - Intergenic
1157279955 18:46340346-46340368 CAACTAAACACATGAAGTACAGG - Intronic
1157906001 18:51570747-51570769 AAACTAAACAGAATAAGAGAAGG + Intergenic
1158376990 18:56882240-56882262 GGACTTAACATATGTAGAGCAGG + Intronic
1159495850 18:69203484-69203506 GAAACAAACAGCTGAAGAACAGG + Intergenic
1159691012 18:71487320-71487342 GACATGAACAGATGAAAAGCAGG + Intergenic
1161664482 19:5567007-5567029 GAAATAAACAGAGGCAGAGATGG + Intergenic
1162984126 19:14258403-14258425 GAAGAAAAGAGAAGAAGAGCAGG - Intergenic
1167008899 19:46793394-46793416 GAGAAAAACAGATGAGGAGCCGG + Intergenic
1167871915 19:52377707-52377729 GAAGGATACAGATGAAGAGCCGG + Intronic
1167917783 19:52756169-52756191 AAACTAAACAGAATAAGAGAAGG - Intergenic
925193408 2:1903971-1903993 GAGCTAGACCGATGAAGAGGTGG - Intronic
927055252 2:19360768-19360790 GAACTTAGTAGATGTAGAGCAGG + Intergenic
927185754 2:20481132-20481154 GAACTAAACAGATGATAAATTGG - Intergenic
927940895 2:27102219-27102241 GAACTAAAGAGAAGAGAAGCTGG + Exonic
929269367 2:39956780-39956802 GAAGTGAAAGGATGAAGAGCAGG - Intergenic
931683554 2:64772510-64772532 GAAATAAATAGGTCAAGAGCTGG + Intergenic
931948662 2:67336858-67336880 AAACTAAACAGAATAAGAGAAGG - Intergenic
932913456 2:75829778-75829800 GAGCCAATCAGATAAAGAGCTGG + Intergenic
933239331 2:79902567-79902589 AAAGATAACAGATGAAGAGCAGG - Intronic
935458282 2:103296214-103296236 AAAATAATCAGATGCAGAGCAGG + Intergenic
938389571 2:130894204-130894226 GAACTAAACAGAAGCACAGAAGG + Intronic
940237632 2:151528054-151528076 GAAATAGACAGCTGAAGAACTGG + Intronic
940675431 2:156720770-156720792 AAACTAAACAGAATAAGAGAAGG + Intergenic
942036699 2:172016903-172016925 GAATTAGCCAGATGAAGAGCTGG - Intronic
943460727 2:188169374-188169396 AAACTAAACAGAATAAGAGAAGG + Intergenic
943835781 2:192512472-192512494 AAACTAAACAGAATAAGAGAAGG - Intergenic
945158915 2:206868328-206868350 GAACTGAAAAGCTCAAGAGCTGG - Intergenic
945618398 2:212103050-212103072 GAAATAAATAGATGGAGAGATGG - Intronic
946481634 2:220062450-220062472 GAACCAACCACATGAAAAGCTGG - Intergenic
947165738 2:227260029-227260051 GAAATAAAAATATGAAGAGCAGG - Intronic
948183739 2:236002956-236002978 GAGCAAAACAAAAGAAGAGCTGG - Intronic
1169624515 20:7549325-7549347 GAAAGATACAGATGAATAGCCGG + Intergenic
1169807799 20:9577181-9577203 GAACTAAGCAGATGAAACCCTGG - Intronic
1170128458 20:12991400-12991422 GAAGTAAACAGAGGAAGGGGTGG + Intergenic
1170730112 20:18966569-18966591 GAACTGAACAGAGGATGAGATGG + Intergenic
1173386134 20:42589739-42589761 GATCAAAACAGATCAGGAGCTGG - Intronic
1173678935 20:44862386-44862408 GATGTACACAGAAGAAGAGCTGG - Intergenic
1177437169 21:21070489-21070511 GAATTGAACAGAGGAAGAGGGGG + Intronic
1179381120 21:40900143-40900165 AAACTAGAGAGATGAAGAGAGGG - Intergenic
1180029559 21:45196711-45196733 GAAATAAGCACATGAAAAGCTGG + Intronic
1181906302 22:26199812-26199834 GAACTAAACAAATGAAGAGGAGG + Intronic
1182724925 22:32437107-32437129 GAACTAAACACATCAGTAGCTGG - Intronic
1182836116 22:33342723-33342745 AAACTAGACAGATGCAGAGCGGG - Intronic
1184143163 22:42591635-42591657 GCACTAAACAGATCAACATCTGG + Intronic
1184606319 22:45576698-45576720 GAGCTAATCAGAGGAAGGGCTGG - Intronic
1184909598 22:47520079-47520101 GACCTAAATAAATGAAGGGCTGG + Intergenic
952343134 3:32461628-32461650 AAACTAAACAGAATAAGAGAAGG + Intronic
952858226 3:37790909-37790931 AAACTATAAAGATGAAGAACAGG + Intronic
954930017 3:54273072-54273094 GAGCAAAACAGCGGAAGAGCTGG - Intronic
955035781 3:55265921-55265943 GCACTAGACAGATGCAGAGGTGG - Intergenic
957059496 3:75470581-75470603 AAACTAAACAGAATAAGAGAAGG + Intergenic
957499847 3:81040684-81040706 GAGCTAAACAGATACAGAGAAGG - Intergenic
958676322 3:97273135-97273157 AAACTAAACAGAATAAGAGAAGG + Intronic
961293906 3:125868799-125868821 AAACTAAACAGAATAAGAGAAGG - Intergenic
962239019 3:133734577-133734599 AAACTAAACAGATGAAGAAAGGG + Intergenic
962908921 3:139830037-139830059 GAACAATACAGGTGAAGAGATGG - Intergenic
964200457 3:154113194-154113216 GAATTACAGAAATGAAGAGCTGG + Intergenic
964681049 3:159339118-159339140 GCACAAAACAGATGAAAACCTGG - Intronic
965385812 3:168045265-168045287 GAAATAAACCGATGAGGAGCGGG + Intronic
967643434 3:191896052-191896074 AAACTAAACAGAATAAGAGAAGG + Intergenic
968184445 3:196622285-196622307 GAAGTGAAGAGATCAAGAGCTGG + Intergenic
968870194 4:3238217-3238239 GAGCTAGACAGAGGAAGGGCTGG + Intronic
969003407 4:4000764-4000786 AAACTAAACAGAATAAGAGAAGG + Intergenic
969180619 4:5437813-5437835 GAACTACACAGGTTTAGAGCTGG - Intronic
969810523 4:9644061-9644083 AAACTAAACAGAATAAGAGAAGG - Intergenic
970105439 4:12577324-12577346 GCACTAGACAGATGAAGAAATGG - Intergenic
971792105 4:31183190-31183212 GAATTAAAAACATGAAGAGTGGG + Intergenic
972129266 4:35809447-35809469 GAACTAAACAGAAAAAAAGAAGG + Intergenic
972454911 4:39244670-39244692 GAACAAAAGAGATGAAGGGTAGG - Intronic
974084532 4:57245103-57245125 GAATAAAACAGATGAAGACCTGG - Intergenic
974919692 4:68223649-68223671 GCACTAAAAAGTTGAAGAGTTGG + Intergenic
975699256 4:77046627-77046649 GAATTAAACAGATGAAGATCAGG + Intergenic
975868595 4:78752701-78752723 GAAATAAACATTTGAAGACCTGG + Intergenic
977155885 4:93573003-93573025 GAACAAAACTGATAAAGATCTGG - Intronic
977232590 4:94469396-94469418 GAACTAATCACGTGAAGAGCTGG + Intronic
979766892 4:124473624-124473646 GAACTTGAAAGATGAAGAGGTGG + Intergenic
982167453 4:152627650-152627672 GAAACAAACAGAAGAGGAGCAGG - Exonic
982346668 4:154367708-154367730 AAACAAAAAAGATGAAGAGGGGG - Intronic
983448446 4:167881327-167881349 AAACTAAACAGAATAAGAGAAGG - Intergenic
983802907 4:171957733-171957755 GAAGTCAACAGGTAAAGAGCAGG + Intronic
984754226 4:183310767-183310789 GAACAAAACAGATGAAGTCCAGG - Intronic
984797774 4:183680769-183680791 GAACCCAAGAGATGAAGAGATGG - Intronic
984805708 4:183749435-183749457 GAAGTGAACAGAAGAAGAGCTGG + Intergenic
986413939 5:7509387-7509409 GTTCAGAACAGATGAAGAGCTGG + Intronic
986554626 5:8999043-8999065 AAACTAAACAGAATAAGAGCAGG + Intergenic
986612197 5:9580400-9580422 GAAGCAAACACATGAATAGCAGG - Intergenic
987716118 5:21573896-21573918 GAAAAGAAAAGATGAAGAGCAGG + Intergenic
988596118 5:32592811-32592833 GTATTAAACAGAGGAAGAACAGG + Intronic
991170572 5:63620196-63620218 CATCTTAACAGATTAAGAGCAGG + Intergenic
992362637 5:76056527-76056549 AAACTAAACAATTGAAGAGGAGG - Intergenic
993077980 5:83259078-83259100 GAAATAAACAGATGATGAGAAGG - Intronic
993390292 5:87312720-87312742 GGACCAAACAGATGAAGAGATGG - Intronic
993488313 5:88514340-88514362 GAAATAAACAGAGGAAGGGAGGG + Intergenic
994776060 5:104036609-104036631 GAACTAAACGGAATAAGAGAAGG - Intergenic
994914810 5:105961723-105961745 GACGTAAACAAATGAAAAGCTGG - Intergenic
994983649 5:106907268-106907290 AAACAAAACAGATGATGACCAGG - Intergenic
995035904 5:107533622-107533644 GATCTAATTAGATGCAGAGCAGG - Intronic
995260586 5:110099622-110099644 TACATAAACAGATGATGAGCTGG + Intergenic
997189979 5:131922865-131922887 AAACTAAACAGATGAGGAAAGGG - Intronic
997255634 5:132425975-132425997 GAACTAAACAGAAGAGAAACAGG - Intronic
999053225 5:148546393-148546415 GAACTAAACATTTTAAAAGCTGG + Intronic
999402120 5:151273370-151273392 GAATTAAGCAGGTGAAGAGATGG + Intergenic
999667233 5:153925805-153925827 GAAGTAAAGAGATGAAAAGTGGG + Intergenic
1000120969 5:158197563-158197585 AAACAAAACAGATGTAGAGAAGG + Intergenic
1000306389 5:159998435-159998457 GAACAAATGAGATGAAGAACTGG + Intergenic
1001331074 5:170762760-170762782 GAACTAAACGGAGTAAGAGAAGG + Intergenic
1004012119 6:11699709-11699731 GAAATAAAGAGAAGTAGAGCTGG + Intergenic
1005111582 6:22287836-22287858 GGAGTAGACAGATGAAGAACTGG + Intronic
1007808701 6:44471084-44471106 GAATAAAACAGCTGAAGACCAGG - Intergenic
1009028482 6:58028342-58028364 CACTTAAACAGATGAAGAGAGGG - Intergenic
1010003789 6:70973958-70973980 CAACTAAAAAGATGAATTGCTGG + Intergenic
1010022920 6:71181915-71181937 GAATAAAACAGATGAAGACATGG - Intergenic
1012384258 6:98659786-98659808 GAAATGAACAGATGAAGTACAGG - Intergenic
1015668106 6:135654596-135654618 GAACTAAATAAATGGAGAGAAGG + Intergenic
1016320175 6:142834235-142834257 GAGATAAACAGATGAAGAAAAGG + Intronic
1016486317 6:144543486-144543508 TGACTCAACAGAGGAAGAGCAGG - Intronic
1016959033 6:149653964-149653986 GAATTGAACAGATGAAGTGTGGG + Intergenic
1019861017 7:3658078-3658100 GCACTCTACAGATGAAGAGAAGG - Intronic
1019993868 7:4710901-4710923 GAACTACACAGACGAGGAGAAGG - Intronic
1020086627 7:5313869-5313891 AAACAAAACAGATGAGAAGCTGG + Intronic
1020420930 7:8004092-8004114 GATCAAAACAGAAGAAGTGCAGG - Intronic
1021188994 7:17598639-17598661 GAACTACTGAGATGTAGAGCAGG - Intergenic
1021839341 7:24709845-24709867 TAACAAAACAGATGCAGAACGGG + Intronic
1022677250 7:32511629-32511651 GGAATTAACAGAGGAAGAGCTGG + Intronic
1024012291 7:45279381-45279403 GATCTAAGCAAATGAACAGCAGG - Intergenic
1026414237 7:70161611-70161633 GACCTAAACAGCTGAAGAAAAGG - Intronic
1027723228 7:81770540-81770562 AAACTAGACAGATTAGGAGCTGG - Intergenic
1032143384 7:129355178-129355200 GCACTAAACAGATTATGAACAGG - Intronic
1032344698 7:131107259-131107281 GAGGTAAACAGAAGAAGAGGAGG - Intergenic
1033470174 7:141640081-141640103 AAACTAAAAAGAGGAAGAGAGGG - Intronic
1033941013 7:146653828-146653850 GAAAGAAACAGAAGAAGAGAAGG + Intronic
1033952599 7:146803550-146803572 GCATTAAACAAATGAAAAGCAGG + Intronic
1036373812 8:8183165-8183187 AAACTAAACAGAATAAGAGAAGG - Intergenic
1038591338 8:28840987-28841009 GACATAAGCAGATGAAGAGAGGG + Intronic
1039160118 8:34608774-34608796 AAACGAAACAGGTGAAGAGGAGG - Intergenic
1039176034 8:34807096-34807118 GAAGTAAAGAGATAAAGAGCAGG - Intergenic
1039947461 8:42142323-42142345 ATAGAAAACAGATGAAGAGCTGG - Intergenic
1040001381 8:42579373-42579395 GAGCAAAACAGAGCAAGAGCTGG - Intergenic
1040578068 8:48671681-48671703 GAGCTAAACAAATAATGAGCTGG - Intergenic
1040959900 8:53020240-53020262 GAACTAGACAGAGGATGAGATGG + Intergenic
1041046332 8:53890344-53890366 GGACTAAACTGATGAAAAGATGG - Intronic
1043182574 8:77104860-77104882 GAACTTAACAACTGAAGAGAAGG - Intergenic
1044765263 8:95565610-95565632 TAAGTAAACTGATTAAGAGCTGG - Intergenic
1044991452 8:97799945-97799967 GAACTCAAAAGATGAAGATTTGG - Intronic
1046078651 8:109342923-109342945 GAACAAAAGAGATGAAGAAAAGG - Intronic
1046485560 8:114883139-114883161 GAAGTCTACAGATGAAGACCTGG + Intergenic
1047069332 8:121325302-121325324 GAGATAGACAGATGAAGAGAGGG + Intergenic
1047856802 8:128919611-128919633 AAACTAAACAGAGTAAGAGAAGG - Intergenic
1048024748 8:130575857-130575879 GAATTAAACAGGTGAAAAGATGG - Intergenic
1048154835 8:131936727-131936749 GAAGGAGACAGATGAACAGCCGG + Intronic
1048443167 8:134475054-134475076 GAATTAAAGAGCTGAAGCGCAGG - Intergenic
1050071107 9:1815225-1815247 GAACTAAAAAAATGAAGAGGAGG + Intergenic
1050308741 9:4331776-4331798 GAAATAACCAGATGAACATCTGG + Intronic
1051782913 9:20710066-20710088 GAACTATACAGAAGAAGATGTGG - Intronic
1052383173 9:27793895-27793917 TAACAAAATAGATGAAGAGATGG + Intergenic
1052424875 9:28291304-28291326 GAAGTGAACAGAAAAAGAGCTGG + Intronic
1054974886 9:71131238-71131260 GAGCTAATCTCATGAAGAGCTGG - Intronic
1055347241 9:75351830-75351852 AAACTAAACAGAATAAGAGAAGG + Intergenic
1056032879 9:82571136-82571158 GAACTAGTAAGCTGAAGAGCTGG - Intergenic
1056252675 9:84766251-84766273 GATCTAGACAGAGGAAGAGTGGG + Intronic
1057073614 9:92122081-92122103 GAACTATAGAAATGAAGAGAAGG - Intergenic
1057446662 9:95120726-95120748 GAACAAAAAAAATGAAGACCTGG - Intronic
1058021207 9:100090766-100090788 CAACAAAACAGCTAAAGAGCAGG + Intronic
1061350961 9:130064518-130064540 CAACTAAACAGATGTAGAAAGGG - Intronic
1187086135 X:16045401-16045423 AAACTAAACAGAATAAGAGAAGG + Intergenic
1188431457 X:30108547-30108569 AAACTAAACAGAACAAGAGAAGG - Intergenic
1188954938 X:36422767-36422789 GATTTAAACATATGAAAAGCAGG - Intergenic
1190291217 X:48993576-48993598 GAGCTGAACAGAGGAAGAGAAGG + Exonic
1193936153 X:87624533-87624555 GAAATTAACACATGAAGAGCAGG + Intronic
1194464416 X:94214859-94214881 GAATTAAATAGATGATCAGCTGG + Intergenic
1194873309 X:99159397-99159419 AAACTAAACAGAATAAGAGAAGG + Intergenic
1197311851 X:124915064-124915086 GAATTAACCAAATGAAGAGATGG - Intronic
1198959949 X:142173663-142173685 GCATGAAACAGAGGAAGAGCAGG + Intergenic