ID: 901725040

View in Genome Browser
Species Human (GRCh38)
Location 1:11235084-11235106
Sequence CTGCTATGACTGGGGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901725040_901725048 1 Left 901725040 1:11235084-11235106 CCTGTTTTCCCCAGTCATAGCAG 0: 1
1: 0
2: 0
3: 11
4: 201
Right 901725048 1:11235108-11235130 CCACAGGGAAAAGAAATGAAGGG 0: 1
1: 0
2: 7
3: 58
4: 741
901725040_901725046 0 Left 901725040 1:11235084-11235106 CCTGTTTTCCCCAGTCATAGCAG 0: 1
1: 0
2: 0
3: 11
4: 201
Right 901725046 1:11235107-11235129 ACCACAGGGAAAAGAAATGAAGG 0: 1
1: 0
2: 4
3: 55
4: 606
901725040_901725049 2 Left 901725040 1:11235084-11235106 CCTGTTTTCCCCAGTCATAGCAG 0: 1
1: 0
2: 0
3: 11
4: 201
Right 901725049 1:11235109-11235131 CACAGGGAAAAGAAATGAAGGGG 0: 1
1: 0
2: 4
3: 86
4: 829

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901725040 Original CRISPR CTGCTATGACTGGGGAAAAC AGG (reversed) Intronic
901725040 1:11235084-11235106 CTGCTATGACTGGGGAAAACAGG - Intronic
903591591 1:24460176-24460198 AAGATATGACTGGGGAAAGCTGG + Intronic
903621430 1:24701029-24701051 CTGCTATGCCTGGCAAAACCTGG - Intergenic
905387000 1:37611974-37611996 CTGCTCTGACGGTGGTAAACAGG - Exonic
910655788 1:89616555-89616577 CTGATTTGTCTGGGGAAAATTGG + Intergenic
912377426 1:109222269-109222291 ATGTTATCATTGGGGAAAACGGG - Intronic
912627984 1:111222029-111222051 CTGCTGTGTGTGGGGGAAACTGG + Intronic
912667657 1:111597195-111597217 CTGCAATGACAGGGGAAAAAAGG - Intronic
913397669 1:118389932-118389954 CTGCTATGCCAGGGGAAGGCAGG - Intergenic
916062793 1:161112460-161112482 CTGCTCAGACTGGTGAAAAGTGG + Intronic
916255623 1:162784788-162784810 ATGTTATAAATGGGGAAAACTGG - Exonic
917912873 1:179669255-179669277 CTGCTCTGACTGGGTAAGAGAGG - Exonic
921301175 1:213752996-213753018 CTTCTAAGACAGGGAAAAACTGG - Intergenic
923346869 1:233062091-233062113 CTGCCCTCACTGGGGAAAATTGG + Intronic
923423350 1:233843171-233843193 CTGCCATGACTTGGGAAATGGGG - Intergenic
923720797 1:236465062-236465084 ATGCGATCACTGGGGAAAACAGG - Intronic
924074248 1:240316806-240316828 ATGCTATCATTGGGGAAAACTGG - Intronic
924814979 1:247433528-247433550 CTGCTGTGACTGGGGAGACTGGG + Intronic
1063715921 10:8527027-8527049 GTGCTATGAATGAGGACAACAGG + Intergenic
1066733412 10:38452493-38452515 CAGCTGTGCCGGGGGAAAACTGG - Intergenic
1078597906 11:12704316-12704338 TTACTATGACTGGGGTGAACTGG - Intronic
1079257142 11:18840887-18840909 CTGCTATCGCTGAGGAATACAGG + Intergenic
1080723753 11:34874527-34874549 CTCCTATGAGTGAGGGAAACTGG + Intronic
1080822716 11:35822385-35822407 TAGCCATGACTGGAGAAAACAGG + Intergenic
1081639782 11:44744920-44744942 CTGCTGAGCCTGGGTAAAACAGG - Intronic
1085244653 11:75090406-75090428 CTGCAATGATTAGGGAAACCTGG + Intergenic
1085556444 11:77426993-77427015 CTGCTATGGCTGGAGCAAATGGG + Intronic
1086511695 11:87565338-87565360 CTTCATTGACTGGGGGAAACAGG + Intergenic
1090236574 11:125152569-125152591 CTGGTGTAACTGGGGCAAACTGG - Intergenic
1091842959 12:3633613-3633635 CCGCCATGCCTGGGGAGAACCGG + Exonic
1093751647 12:22806892-22806914 CTGGTAGAACTGGGGAAAGCTGG + Intergenic
1095728378 12:45476820-45476842 CTCCTTTGACTGGGGACAGCAGG + Intergenic
1097713650 12:62941881-62941903 TTGCTTTGACTGTGGAAAATAGG + Intergenic
1098556816 12:71828182-71828204 ATGCTATCACTGGGAAAAACTGG - Intergenic
1100418385 12:94403050-94403072 CTGCAATGACTGAGTAAAAGGGG + Intronic
1101756533 12:107625453-107625475 CTGCTCTGACAGGGGAAGAGTGG + Intronic
1102481629 12:113227748-113227770 CTGCCCTGACTGGGGAGCACTGG - Intronic
1102496789 12:113325198-113325220 CTGCTGTGAATGCAGAAAACTGG - Intronic
1102603400 12:114050540-114050562 CTGATATGGCTGGGGGAAAGTGG - Intergenic
1102830324 12:115992064-115992086 CTGCTATCACTGGGATACACTGG + Intronic
1103221903 12:119253200-119253222 CTGCTATGTTTGGGGAAACAAGG - Intergenic
1105247669 13:18667267-18667289 CTGCTGAGACGGGGGAAATCAGG + Intergenic
1105792219 13:23812708-23812730 ATGCTACCACTGGAGAAAACTGG + Intronic
1107134956 13:36933660-36933682 ATGCTACCACTGGGGGAAACTGG - Intergenic
1107596657 13:41970175-41970197 GTGGTAGGCCTGGGGAAAACAGG + Intergenic
1108213495 13:48161240-48161262 CAGCCATGACAGGGGAAAAAGGG + Intergenic
1110116073 13:71818239-71818261 ATGCTATAATTAGGGAAAACAGG + Intronic
1110310029 13:74038176-74038198 ATGCTACCAGTGGGGAAAACTGG + Intronic
1110460323 13:75737897-75737919 CTGCTGGAAATGGGGAAAACTGG - Intronic
1111402584 13:87760540-87760562 CTGCTTTTTCTGTGGAAAACAGG + Intergenic
1111861029 13:93706334-93706356 CTGATATGATTGGGTATAACTGG - Intronic
1112148844 13:96733771-96733793 CTTCTGTGACTGGGGAAATGGGG - Intronic
1112800723 13:103107119-103107141 CTCATATGGCTGGGGATAACTGG + Intergenic
1115879728 14:37901932-37901954 CTGCTAGAAGTGGAGAAAACAGG + Intronic
1116428545 14:44819965-44819987 GTGATATGACTGAAGAAAACAGG + Intergenic
1117357763 14:54942369-54942391 ATGTTACCACTGGGGAAAACTGG - Intronic
1119577257 14:75736492-75736514 GTGATATGACTGAGGTAAACTGG + Intronic
1121774393 14:96581044-96581066 CTGCTGTGAGTTGTGAAAACCGG - Intergenic
1122061878 14:99141373-99141395 CTGGGATGAATGGGGAAGACGGG - Intergenic
1125349328 15:38751470-38751492 CTCCTGAGACTTGGGAAAACTGG + Intergenic
1125460920 15:39905957-39905979 ATGCTACCACTGGGGGAAACTGG + Intronic
1129883975 15:79025958-79025980 CTGCCATGGCTGTGGACAACAGG - Intronic
1132411607 15:101582672-101582694 ATGCTACCACTGGGGGAAACTGG - Intergenic
1133426390 16:5693948-5693970 CTACTCTAACTGGGGAAAATGGG - Intergenic
1136619849 16:31421269-31421291 CTCCAAGGACTGGGGAAAGCTGG + Intronic
1137244705 16:46693101-46693123 TTGCTGTGTCTGGGGAAGACTGG - Exonic
1139548765 16:67662026-67662048 CGTCTATGACTGAGGAAACCTGG - Exonic
1139954924 16:70688508-70688530 GGGCTAGGACTGGGGAAAATGGG + Intronic
1140651579 16:77094185-77094207 GTGCTAGGACTGAGGAAGACAGG - Intergenic
1141689894 16:85590865-85590887 CGGCTAGCCCTGGGGAAAACGGG - Intergenic
1145304507 17:21666016-21666038 CTGCAAGGCCTGGGGAAGACTGG - Intergenic
1145920875 17:28608740-28608762 CAGCTATGCATGGGGAAATCTGG + Intronic
1146501221 17:33366112-33366134 ATGCTATGAGTGGGGACAAAAGG + Intronic
1151864002 17:76787770-76787792 CAGCCATGACCGGGGAAAAAAGG + Intergenic
1155132580 18:22953206-22953228 CTGCTATAAATGAGGAAAGCAGG - Intronic
1156596822 18:38557132-38557154 CTGCTGTGAGTGGGGAGAAGGGG - Intergenic
1157626855 18:49057918-49057940 CTGCTCTGACTGGTGGAGACTGG + Intronic
1158382899 18:56954581-56954603 AAGCTATGACTGGTGAATACTGG + Intronic
1158850413 18:61491002-61491024 CTGTTATGAATGGGAAAAAGTGG + Intronic
1160840790 19:1146302-1146324 CGGCCCTGAGTGGGGAAAACTGG + Intronic
1161387481 19:4003770-4003792 ATACTATCACTGGGGAAAGCTGG + Intergenic
1161438502 19:4278220-4278242 CTGCTATGACTGGGGCCTCCTGG - Intergenic
1164306236 19:24006100-24006122 CTGCTATGATTTGGAAAAATTGG - Intergenic
1168444077 19:56396670-56396692 CGGATATGGCTGGGGATAACAGG - Intergenic
927363617 2:22267536-22267558 CTGGTATGGCTGATGAAAACAGG + Intergenic
932095271 2:68841919-68841941 CTGCTATTGGTGGGGGAAACAGG + Intergenic
932568633 2:72924943-72924965 CTGCTGTTCCTGGGCAAAACTGG + Intronic
932778096 2:74540524-74540546 TTGGTTTGACTGGGGAACACAGG + Intronic
938250339 2:129810920-129810942 CTACTCTGGCTGGGGAGAACAGG + Intergenic
939842695 2:147207779-147207801 TTGCTATCACTGTGGAAGACAGG + Intergenic
940812161 2:158257148-158257170 CAGCTAGGACTGAGGAAAGCAGG - Intronic
942175135 2:173326044-173326066 ATGTTACCACTGGGGAAAACTGG - Intergenic
943644899 2:190399722-190399744 ATGCTAACACTGGGGAAAGCTGG + Intergenic
947106886 2:226676827-226676849 CTGCTGTGGCTGGGGAGGACAGG + Intergenic
947967414 2:234293024-234293046 GTGTTATCACTGGGGGAAACTGG - Intergenic
948890231 2:240903777-240903799 CTGCAGTGACTGAGGAAAAGGGG + Intergenic
1169697364 20:8405479-8405501 CTGCTAAATCGGGGGAAAACTGG - Intronic
1169995592 20:11552753-11552775 CTCTCATGACTGGGGATAACTGG - Intergenic
1174609392 20:51786695-51786717 GTGCTACCAATGGGGAAAACTGG + Intronic
1174731035 20:52917928-52917950 GTGCTATCACTGGAGAAAAGGGG - Intergenic
1175377196 20:58536264-58536286 CTTCTCTGATTGGGGAAACCAGG + Intergenic
1175777201 20:61660853-61660875 CTGCCAGGACTGTGGAAACCGGG - Intronic
1176454884 21:6899323-6899345 CTGCTGAGACGGGGGAAATCAGG + Intergenic
1176655827 21:9588443-9588465 CTGCAAGGCCTGGGGAAGACTGG - Intergenic
1176833057 21:13764371-13764393 CTGCTGAGACGGGGGAAATCAGG + Intergenic
1177071514 21:16514504-16514526 CTGCTAAGACTGCGGGAAAAGGG - Intergenic
1178972420 21:37192708-37192730 CTGCTATGCCTGAGGCATACAGG + Intronic
1180976380 22:19851082-19851104 CTGCTCTGACTGGGGACTATGGG + Exonic
1181413173 22:22739249-22739271 CTGCTATGGCTGGAGAAAGAGGG - Intronic
1181423827 22:22819990-22820012 CAGCTGTGACTTGGGAAAATAGG + Intronic
1181737052 22:24890394-24890416 CTGTTACCACTGGGGAAAGCTGG - Intronic
1182637733 22:31742116-31742138 GTGCTGTGACAGGTGAAAACTGG - Intronic
950680441 3:14581477-14581499 CTGCTATGATTGGATAAACCTGG - Intergenic
952208707 3:31206737-31206759 AAGTTATCACTGGGGAAAACTGG - Intergenic
954232753 3:49230329-49230351 CTGCTATGATTCCGAAAAACTGG + Intronic
955024151 3:55151148-55151170 ATGTTATCACTGGGGAAAACTGG - Intergenic
959097554 3:101972078-101972100 CTCCAGTGACTGGGGAAAATAGG + Intergenic
959575701 3:107930970-107930992 ATGCTGTGAGTGGGTAAAACAGG + Intergenic
959645326 3:108693043-108693065 TTGCTTTGACTGTGGAAAACAGG - Intronic
961077170 3:123992762-123992784 CTGAGATGCCTGGGGACAACAGG + Intergenic
961079068 3:124009420-124009442 CTGAAATGCCTGGGGAGAACAGG + Intergenic
961307405 3:125968538-125968560 CTGAGATGCCTGGGGACAACAGG - Intergenic
970524382 4:16916773-16916795 CTGTTCTGACTGGGGAAAGAGGG - Intergenic
971931480 4:33089635-33089657 ATCCTATGAATGGGGAAGACTGG - Intergenic
973869465 4:55150572-55150594 CTTCAATGACTGTGGAAACCAGG - Intergenic
975331749 4:73123787-73123809 GTGCTATGACTGGGGGGAAGTGG + Intronic
975489624 4:74974349-74974371 CTGCTATGACAGTGGAGACCTGG - Intronic
976965145 4:91029596-91029618 CTTCTATGACTTTGAAAAACAGG - Intronic
977442526 4:97087278-97087300 CTGCATAGACTGGGGAATACTGG - Intergenic
981314314 4:143326716-143326738 CTGCTCTGGCTGGGGAGAAGAGG - Intergenic
981424039 4:144583199-144583221 ATGCTATGACTGCTGAAAAAAGG - Intergenic
982054660 4:151536201-151536223 CTGTTACCACTGGGGGAAACTGG - Intronic
982596907 4:157397003-157397025 CTATTATCATTGGGGAAAACTGG + Intergenic
984744321 4:183199222-183199244 CTGGTGTGACTGGGGTAACCGGG + Intronic
985136302 4:186789058-186789080 TAGGTGTGACTGGGGAAAACAGG + Intergenic
985246610 4:187985268-187985290 CTGCCATGACTGGGATAAAATGG + Intergenic
985362923 4:189194406-189194428 AGGATATCACTGGGGAAAACCGG - Intergenic
985985791 5:3515207-3515229 CTGGTATTACTGGGGACACCGGG - Intergenic
986060877 5:4188875-4188897 CTGCTCTGCCTGGGGAATGCTGG + Intergenic
987100721 5:14589230-14589252 GTGCTATGAGAGAGGAAAACAGG + Intronic
989053510 5:37344568-37344590 CTGATATAACTGGAGAAAAATGG + Intronic
990825282 5:59892672-59892694 CTGCTCTGACTGGGGAGGAGGGG - Intronic
993249485 5:85500090-85500112 ATGCTATTACTGGGGAAAATTGG + Intergenic
993943049 5:94084748-94084770 ATCATATCACTGGGGAAAACAGG + Intronic
995025956 5:107422822-107422844 GTGCCATGAGTGGGGAAAACAGG + Intronic
997365833 5:133324707-133324729 CCGGTATGACTGTGGAAGACAGG + Intronic
997676762 5:135719058-135719080 ATGTTATCACTGAGGAAAACTGG + Intergenic
998293005 5:140934966-140934988 GTGTTATCACTGGGGAAAAGTGG - Intronic
998568838 5:143239244-143239266 CTGCTAGGGTTGGGAAAAACAGG + Intergenic
998815850 5:146013423-146013445 CAGAAATGACTGGGGAAAATGGG + Intronic
999583944 5:153069999-153070021 ATTTTATCACTGGGGAAAACTGG - Intergenic
999674440 5:153984772-153984794 CTGTTATCATTGGGGGAAACTGG - Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1005292902 6:24396679-24396701 CTGCTATGGCTTGGGATAAAAGG + Intergenic
1006907889 6:37545352-37545374 CTGGGCTGACTGGGGAACACGGG + Intergenic
1008534711 6:52499032-52499054 CAGCTTTCACTGGGGAGAACTGG + Exonic
1008652589 6:53578072-53578094 CTGCTACTACTGGGGAGAATAGG + Intronic
1008735286 6:54535894-54535916 CTGTTATCACTGGGGAAAGTAGG - Intergenic
1011764361 6:90604177-90604199 CTGGTGTGACTGGTGTAAACTGG - Intergenic
1012859537 6:104543237-104543259 TTACTATGACTGGGGTAAAATGG - Intergenic
1013577252 6:111496194-111496216 CTGCTACTACAGGGGAAAAAAGG - Intergenic
1015200653 6:130576232-130576254 CTGCTCTAACAGGGGCAAACTGG - Intergenic
1016466902 6:144334635-144334657 TGGCTATGACTGAGGAAGACAGG + Intronic
1019550512 7:1599936-1599958 CGCCTGTGACTGGGGAGAACAGG + Intergenic
1021767116 7:23960964-23960986 ATACCATGACTGGGGAGAACAGG - Intergenic
1021774737 7:24041613-24041635 TTGTTACAACTGGGGAAAACTGG - Intergenic
1022806951 7:33831945-33831967 CTGCTTTGGCTGGGGAAGGCCGG - Intergenic
1025302203 7:57826780-57826802 CTGCAAGGCCTGGGGAAGACTGG + Intergenic
1029067211 7:97862676-97862698 ATGTTAAGAGTGGGGAAAACTGG + Intronic
1029227503 7:99038729-99038751 CTTCTATGACTGTGGAAGCCAGG - Intronic
1030576765 7:111297301-111297323 ATGTTATCACTGGAGAAAACTGG + Intronic
1031510172 7:122639408-122639430 GTGCTATCATTAGGGAAAACTGG - Intronic
1031998641 7:128249628-128249650 TTTCTATGACTGGGGAAGAACGG + Intronic
1032748979 7:134817399-134817421 ATGTTACTACTGGGGAAAACTGG - Intronic
1034791580 7:153975150-153975172 TTGCTAGGACTGGGGAATTCGGG + Intronic
1037468916 8:19188144-19188166 CAGCTATGATTGGGTAAATCAGG - Intergenic
1037833776 8:22204367-22204389 CAGCTTTCACTGGGGGAAACAGG - Intronic
1038126788 8:24682946-24682968 CTGCTATGACTCAGCAAAATGGG - Intergenic
1040104355 8:43533163-43533185 CTCCTAGGACTGAAGAAAACTGG + Intergenic
1040605384 8:48926731-48926753 CTGGTATGACTTGGGAAAAGGGG - Intergenic
1041437337 8:57856928-57856950 CTGCTATGACAAGGGACTACAGG - Intergenic
1044055351 8:87562942-87562964 ATGCTATCATTGAGGAAAACGGG - Intronic
1044980502 8:97711547-97711569 ATGTTACCACTGGGGAAAACTGG - Intronic
1047889775 8:129294847-129294869 CTGCTCTGACTCAGGAAACCTGG - Intergenic
1048165981 8:132061809-132061831 ATGGTATGACTGTAGAAAACTGG + Intronic
1048620900 8:136132022-136132044 CTGCTATAACTGGGGAGTTCAGG + Intergenic
1049234572 8:141506093-141506115 CTGCTGTGCCTGGGGGAAGCCGG - Intergenic
1051491279 9:17669178-17669200 ATGTTACCACTGGGGAAAACTGG - Intronic
1054869977 9:70040260-70040282 CTCTTATTACTTGGGAAAACAGG - Intergenic
1055381305 9:75709898-75709920 CTGCTCTGACTGGTGGAAACAGG + Intergenic
1055744367 9:79426767-79426789 TTTCTATGACTGGGGACACCTGG + Intergenic
1057073595 9:92121895-92121917 ATGTTAACACTGGGGAAAACTGG - Intergenic
1057264484 9:93605086-93605108 ACGCTATGAATGGGGAAATCGGG - Intronic
1057842210 9:98495317-98495339 CTGCTCTGACTGGTGTAACCTGG + Intronic
1058232558 9:102447293-102447315 CTGCTGTGACAGGGGAGCACTGG - Intergenic
1060471712 9:123953270-123953292 TTGTTATGACTGGGGAAAGCAGG + Intergenic
1060632545 9:125172907-125172929 ATGTTACCACTGGGGAAAACTGG + Intronic
1203633544 Un_KI270750v1:91904-91926 CTGCAAGGCCTGGGGAAGACTGG - Intergenic
1186725354 X:12352075-12352097 GTGCTAACACTTGGGAAAACTGG - Intronic
1187068456 X:15864313-15864335 CTGCTATTTCTGGGGCAAGCAGG - Intergenic
1187277161 X:17826299-17826321 CTGATATGAGAGAGGAAAACTGG - Intronic
1187591878 X:20725696-20725718 CCCCTAGGACTGGGGAACACGGG + Intergenic
1188079972 X:25826977-25826999 CTTCTCTGACTGGTGGAAACAGG - Intergenic
1189104637 X:38222690-38222712 CTGCCATAACTGGGGAAAGGGGG - Intronic
1189174013 X:38935831-38935853 CCGCTGTGACTGAGGAAAATAGG - Intergenic
1189745239 X:44162104-44162126 CTGTTATGTATGGGGACAACAGG + Intronic
1193224272 X:78963481-78963503 CTGCTATGTCTGTGGAGAAATGG + Intergenic
1197056312 X:122124031-122124053 CTGGTATGAATGGGGAGAAAAGG + Intergenic
1197495508 X:127174276-127174298 CTGCTATGAGTCCGGAAAAGGGG - Intergenic
1198719454 X:139600158-139600180 CTGCTTAGATTGGGGAAAAAAGG + Intronic
1199672039 X:150155569-150155591 CACCCAGGACTGGGGAAAACTGG + Intergenic
1200240261 X:154489670-154489692 CTGCTAGAACTGGGGCAACCAGG + Intronic
1201334505 Y:12865667-12865689 CTACTATGAAAGGGGAAAATTGG - Intergenic