ID: 901726005

View in Genome Browser
Species Human (GRCh38)
Location 1:11242621-11242643
Sequence GGGTGTCTTCGCTAAGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901726005_901726013 6 Left 901726005 1:11242621-11242643 CCCTCGCCTTAGCGAAGACACCC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 901726013 1:11242650-11242672 CTCCATCTGGCAGGATGCTGAGG 0: 1
1: 0
2: 4
3: 31
4: 291
901726005_901726010 -3 Left 901726005 1:11242621-11242643 CCCTCGCCTTAGCGAAGACACCC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 901726010 1:11242641-11242663 CCCCAGTCTCTCCATCTGGCAGG 0: 1
1: 0
2: 1
3: 37
4: 329
901726005_901726014 7 Left 901726005 1:11242621-11242643 CCCTCGCCTTAGCGAAGACACCC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 901726014 1:11242651-11242673 TCCATCTGGCAGGATGCTGAGGG 0: 1
1: 0
2: 1
3: 15
4: 202
901726005_901726016 8 Left 901726005 1:11242621-11242643 CCCTCGCCTTAGCGAAGACACCC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 901726016 1:11242652-11242674 CCATCTGGCAGGATGCTGAGGGG 0: 1
1: 0
2: 2
3: 21
4: 209
901726005_901726008 -7 Left 901726005 1:11242621-11242643 CCCTCGCCTTAGCGAAGACACCC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 901726008 1:11242637-11242659 GACACCCCAGTCTCTCCATCTGG 0: 1
1: 0
2: 2
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901726005 Original CRISPR GGGTGTCTTCGCTAAGGCGA GGG (reversed) Intronic
901726005 1:11242621-11242643 GGGTGTCTTCGCTAAGGCGAGGG - Intronic
903181843 1:21608733-21608755 AGGTGTCCCCGCTAAGGCCAAGG + Intronic
1089259963 11:117217566-117217588 GGGTGGCTTCCCTCAGGTGAAGG - Intronic
1091263177 11:134250048-134250070 GGGTGTCCTGGCAAAGGGGAAGG - Intronic
1105258875 13:18763991-18764013 GGGGGTCTTAGCTAAGATGATGG - Intergenic
1124160283 15:27262116-27262138 GGGCATCCTTGCTAAGGCGATGG + Intronic
1130301139 15:82680494-82680516 GGGCGTCATCGCCAAGGCGCTGG - Exonic
1133970770 16:10566456-10566478 GGGAGTCTTAGCTGAGGCTAAGG - Intronic
1138622865 16:58225695-58225717 GGGTCTCTTTACTAAGGTGAAGG + Intergenic
1139696433 16:68678575-68678597 GGGTGTCTTCGCTGTAGAGAAGG + Exonic
1142030140 16:87834517-87834539 GGGTGTCTTCCAGAAGGAGACGG + Exonic
927002673 2:18814925-18814947 GGGTGTCTTCCCTGGGACGATGG - Intergenic
928277958 2:29920112-29920134 TGGTGGATTCGCCAAGGCGAAGG - Exonic
934493568 2:94778997-94779019 GGGGGTCTTAGCCAAGACGATGG - Intergenic
948545678 2:238727058-238727080 GGGTGCCTTGGCTAATGTGAAGG + Intergenic
1170801474 20:19593977-19593999 GGGTCTCTGTGCTAAGGCTAGGG - Intronic
1184346138 22:43914451-43914473 GGGTGTCTTCCCTGAGGAAATGG + Intergenic
986081364 5:4398203-4398225 GGGGGTCTTCGCTAACACAATGG + Intergenic
990196637 5:53324331-53324353 GAGTGTCTTGGCAAAGGGGATGG - Intergenic
1017098117 6:150823170-150823192 GGGTGTCTTCTCTAAGGATGTGG + Intronic
1019365022 7:628781-628803 GGGTTTCTTGGAAAAGGCGAGGG - Intronic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1031543354 7:123023263-123023285 GGGTGTCTTCCCTCAGGCTGGGG - Intergenic
1032727007 7:134599459-134599481 GGGTGACTTCGCTTTGGCTAGGG + Intergenic
1042954113 8:74230275-74230297 GGGTTTCTTCTCTAAAGCAAAGG - Intergenic
1053462375 9:38280804-38280826 GGCTGTGCTCCCTAAGGCGAGGG + Intergenic
1061013586 9:127969278-127969300 GGTTGTCTTGGCCAAGGCAATGG + Intronic
1189351518 X:40279249-40279271 GGGTATCTTCTCTCAGGCCAAGG + Intergenic
1190649526 X:52555560-52555582 GGCTGTCCTCGCCAAGGGGAAGG + Intergenic
1200084234 X:153595506-153595528 CAGGGTCTTCGCCAAGGCGAGGG - Intronic