ID: 901728723

View in Genome Browser
Species Human (GRCh38)
Location 1:11262512-11262534
Sequence CAGCGGGGAAGGCGGGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 305}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901728723_901728738 6 Left 901728723 1:11262512-11262534 CCCACCGCCCGCCTTCCCCGCTG 0: 1
1: 0
2: 2
3: 37
4: 305
Right 901728738 1:11262541-11262563 AAGCCGGGAGCGAGGGAAGGAGG 0: 1
1: 0
2: 9
3: 287
4: 3099
901728723_901728737 3 Left 901728723 1:11262512-11262534 CCCACCGCCCGCCTTCCCCGCTG 0: 1
1: 0
2: 2
3: 37
4: 305
Right 901728737 1:11262538-11262560 TCTAAGCCGGGAGCGAGGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 110
901728723_901728734 -2 Left 901728723 1:11262512-11262534 CCCACCGCCCGCCTTCCCCGCTG 0: 1
1: 0
2: 2
3: 37
4: 305
Right 901728734 1:11262533-11262555 TGTCCTCTAAGCCGGGAGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 57
901728723_901728730 -9 Left 901728723 1:11262512-11262534 CCCACCGCCCGCCTTCCCCGCTG 0: 1
1: 0
2: 2
3: 37
4: 305
Right 901728730 1:11262526-11262548 TCCCCGCTGTCCTCTAAGCCGGG 0: 1
1: 0
2: 1
3: 15
4: 165
901728723_901728741 22 Left 901728723 1:11262512-11262534 CCCACCGCCCGCCTTCCCCGCTG 0: 1
1: 0
2: 2
3: 37
4: 305
Right 901728741 1:11262557-11262579 AAGGAGGGTTCCCAGCCCTGAGG 0: 1
1: 0
2: 1
3: 40
4: 274
901728723_901728739 7 Left 901728723 1:11262512-11262534 CCCACCGCCCGCCTTCCCCGCTG 0: 1
1: 0
2: 2
3: 37
4: 305
Right 901728739 1:11262542-11262564 AGCCGGGAGCGAGGGAAGGAGGG 0: 1
1: 0
2: 11
3: 740
4: 5429
901728723_901728735 -1 Left 901728723 1:11262512-11262534 CCCACCGCCCGCCTTCCCCGCTG 0: 1
1: 0
2: 2
3: 37
4: 305
Right 901728735 1:11262534-11262556 GTCCTCTAAGCCGGGAGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 78
901728723_901728729 -10 Left 901728723 1:11262512-11262534 CCCACCGCCCGCCTTCCCCGCTG 0: 1
1: 0
2: 2
3: 37
4: 305
Right 901728729 1:11262525-11262547 TTCCCCGCTGTCCTCTAAGCCGG 0: 1
1: 0
2: 0
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901728723 Original CRISPR CAGCGGGGAAGGCGGGCGGT GGG (reversed) Intergenic
900531408 1:3155230-3155252 CACCGGCCAAGGCAGGCGGTGGG + Intronic
900995970 1:6123958-6123980 CAGCGGGGCTGGCAGGAGGTGGG + Exonic
901483215 1:9539976-9539998 CCGCGGGGAGGACGGGCGGCGGG - Intronic
901643432 1:10704563-10704585 CTGGGGGGAAGGGGGCCGGTAGG + Intronic
901660533 1:10795694-10795716 CAGCTGGGGAGGCAGGGGGTGGG + Intronic
901728723 1:11262512-11262534 CAGCGGGGAAGGCGGGCGGTGGG - Intergenic
901844703 1:11974600-11974622 CAGACGGGCAGGGGGGCGGTGGG + Intronic
902374043 1:16021931-16021953 CGGCGGGGAAGGGGGGTGGCAGG + Intronic
903263431 1:22143145-22143167 CGGCGGCGGAGGCGGGCGGGCGG + Intronic
905829127 1:41050134-41050156 CAGTGGGGAAGGGGTGCAGTGGG + Intronic
906071855 1:43022529-43022551 CAACTGGAAAGGCTGGCGGTAGG + Intergenic
906521934 1:46472357-46472379 CAGGGGGGCAGGCGGGCGGCTGG - Intergenic
907386515 1:54129124-54129146 CAGCAGGGAAGCTGGGAGGTGGG + Intergenic
908501144 1:64745034-64745056 CCGCGGGGAAGGGGGGCGGTGGG - Intergenic
911705361 1:101005661-101005683 CAGGGTGGAAGGCAGGGGGTTGG + Intronic
913089412 1:115466357-115466379 CAGGGAGGAAGGAGGGCTGTGGG - Intergenic
913565479 1:120069130-120069152 CGGCGGGGAACCCCGGCGGTTGG + Intronic
914286068 1:146228485-146228507 CGGCGGGGAACCCCGGCGGTTGG + Intronic
914547099 1:148679238-148679260 CGGCGGGGAACCCCGGCGGTTGG + Intronic
914619408 1:149391124-149391146 CGGCGGGGAACCCCGGCGGTTGG - Intergenic
915462060 1:156076226-156076248 CAGCGGGGGAGGTGGGCAGAGGG + Exonic
916792648 1:168137083-168137105 CAGCCGGGAGGGCGGGCGGACGG - Intronic
917730872 1:177873381-177873403 CCACGGGGAAGGCAGGCGGGAGG - Intergenic
919078009 1:192836015-192836037 AAGAGGGGAAGGCAGGCGGGTGG + Intergenic
920795308 1:209131111-209131133 CAGCGGTGGTGGCGGGCGGGGGG + Intergenic
922440891 1:225653763-225653785 CCGCGGCGAGGGCGGGCAGTTGG - Intergenic
922742771 1:228023852-228023874 CAGGGGAGAAGGCAGGCGGGTGG - Intronic
923126751 1:231040223-231040245 CAGCGGGGCAGGCGCGTGGCCGG - Exonic
924624507 1:245687867-245687889 CCGCCGGGAAGGCGGCTGGTTGG - Exonic
924854026 1:247857782-247857804 CGGGGGGGACGGCGCGCGGTGGG - Intronic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1064372456 10:14764524-14764546 CACCAGGGAAGGCCGGAGGTTGG - Intronic
1064622380 10:17229147-17229169 AAGCGGGGAGGGTGGGCGGGTGG - Intronic
1065099705 10:22321191-22321213 CTGTGGGGGAGGCGGGCGGGCGG - Exonic
1065861663 10:29877271-29877293 CAGCGGGGAAGCCGGGGGTGGGG + Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067937334 10:50623486-50623508 CAGCGGGGAGGTCCGGCGGCCGG - Intronic
1069963023 10:72089406-72089428 CAGCGGGGAAGGCTGGAGGCTGG + Intergenic
1070328646 10:75403315-75403337 CTGCGGGGATGGCGGCAGGTGGG - Intergenic
1072349800 10:94545727-94545749 CAGCGGGGCGGGAGGGCGGGTGG + Intronic
1072521295 10:96232197-96232219 CAGCGGGGCAGGAGGGAGCTGGG - Intronic
1073136871 10:101225023-101225045 CAGCGGGGCAGGCGTGCGGCTGG - Intergenic
1074528426 10:114280428-114280450 CGGTGGGGTAGGCGGGGGGTTGG + Intronic
1075421972 10:122308603-122308625 AAGCAGGGAAGGAGGGAGGTTGG - Intronic
1075519616 10:123135995-123136017 GAGCGGGACAGGCGGGCGGCGGG - Exonic
1075672246 10:124270606-124270628 CAGCAGGGAAGGAGGGGGCTGGG - Intergenic
1076831065 10:132994510-132994532 CAGCGGGGAAGGCCGACGGGTGG + Intergenic
1076908245 10:133373693-133373715 CAGGCGGGCAGGCGGGCGGGGGG - Intergenic
1077102515 11:828459-828481 CAGGTGGGAAGGTGGGCGGAAGG - Intronic
1077271889 11:1685343-1685365 CAGAGGGGAAGGCGGGCAGGTGG - Intergenic
1077664456 11:4095106-4095128 AAGCAGCGAAGGCGGGCGGGCGG - Intronic
1082009875 11:47442627-47442649 CAGCGGGGAAGGGGGCAGGTCGG - Intronic
1082174905 11:49048580-49048602 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1082243223 11:49892181-49892203 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1082657723 11:55873006-55873028 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1083259742 11:61516503-61516525 CCGCGGGGCAGGCGGGTGGTGGG + Intronic
1083478350 11:62928076-62928098 GGGCGGGGAAGGGGGGCTGTGGG - Intergenic
1083711951 11:64555034-64555056 CAGCTGAGCAGGCGGGCGGTTGG - Intergenic
1083743516 11:64723101-64723123 CGGCGGGGCGGGCGGGCGGGCGG - Exonic
1083766660 11:64844681-64844703 CAGCGGGGAGGGCGGGAGAGGGG - Intergenic
1083849029 11:65354808-65354830 CTGCGCGGACGGCGGGCGGGCGG - Exonic
1083883129 11:65558076-65558098 CAGCGGGGGAAGCGGGCGGGAGG + Exonic
1084569411 11:69950453-69950475 CAGCTGGGAAGCCGGTGGGTGGG + Intergenic
1084599674 11:70137419-70137441 CAGCGGTGATGGCGGGTGGGGGG - Intronic
1084725586 11:70939717-70939739 CAGCGGGGAGGGCTGCGGGTAGG - Intronic
1084892575 11:72243872-72243894 CCGCGGGGAAAGCGGGCCGCAGG + Exonic
1085388740 11:76171531-76171553 CAGTGGGGATGGCAGGCGGGAGG + Intergenic
1086690869 11:89787506-89787528 CAGCGGGGCAGGTGGGAGGCCGG - Intergenic
1086697651 11:89864004-89864026 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1086708508 11:89980484-89980506 CAGCGGGGCAGGTGGGAGGCCGG - Intergenic
1086714931 11:90052149-90052171 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1089573000 11:119422610-119422632 CTGGGTGGAAGGCGGGCGGACGG - Intronic
1091121905 11:133064335-133064357 CAGCCGGGAAGGCGGCCAGGCGG - Intronic
1091747163 12:2999791-2999813 GAGCGGGGAAGGCGGGGAGCAGG - Intronic
1091789966 12:3266442-3266464 GGGCAGGGAAGGCGGGCCGTGGG + Intronic
1091901199 12:4145507-4145529 CAGCTGGAAAGGCAGGAGGTGGG - Intergenic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1094234795 12:28151455-28151477 AAGAGGGGAAGGTGGGAGGTGGG - Intronic
1095753001 12:45730418-45730440 CGGCGGGGAATGCGGGCGTGCGG + Intronic
1096372901 12:51083478-51083500 GGGCGGGGAGGGAGGGCGGTGGG + Exonic
1097352393 12:58562752-58562774 CGGCGGTGGAGGGGGGCGGTTGG - Intronic
1097787719 12:63779781-63779803 CTGGGCGGGAGGCGGGCGGTGGG + Exonic
1097990265 12:65825602-65825624 GCCCGGGGAAGGCGGGAGGTGGG + Intronic
1099713726 12:86264464-86264486 CAGCGGGGGAGGCGGGGAGGGGG + Intronic
1101479623 12:105084469-105084491 CAGCGCGGGAGGCAGGCGGGCGG + Exonic
1102150988 12:110689088-110689110 CAGCGGTGACCGCGGGCGGGTGG - Intronic
1103521134 12:121537550-121537572 CAGCCGGGGAGGAGGGCGGCAGG + Intronic
1103856332 12:123973116-123973138 CGGGGGCGGAGGCGGGCGGTGGG + Exonic
1104464779 12:128981333-128981355 GAGCGGGGAAGGAGGGGGTTGGG + Intronic
1104928708 12:132327276-132327298 CAGTGGGGGCGGTGGGCGGTGGG + Intronic
1105927103 13:25018371-25018393 CAGTGGCGAAGTCGGGCTGTGGG - Intergenic
1106052662 13:26206199-26206221 CAGCAGGGACGGGGGGCAGTGGG - Intronic
1106173461 13:27308682-27308704 CAGAGGGGCAGGCTGGCGGGTGG + Intergenic
1106590067 13:31091420-31091442 GAGCGGGGGCGGCGGGGGGTTGG - Intergenic
1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG + Intronic
1112402246 13:99086840-99086862 CACTGGGGAAGGTGGGGGGTCGG + Intergenic
1112566205 13:100553012-100553034 CAGAGGGGACGGTGGGCTGTTGG + Intronic
1113417340 13:110138492-110138514 GCGCGGGGCAGGCGGGCGGGCGG + Intergenic
1114422781 14:22598449-22598471 CTCCGGGGAGGGCGGGGGGTGGG + Intronic
1114519012 14:23321498-23321520 CAGCGGGGGCTGCGGGCGGTCGG + Exonic
1115519113 14:34215044-34215066 CAGGCGGGCAGGCGGGCGGGCGG + Intronic
1115754780 14:36519859-36519881 GAGCGGGGAGGGCAGGAGGTGGG + Intronic
1117548678 14:56812588-56812610 CAGAGGGGAAGGCCGGAGGAAGG + Intergenic
1118359678 14:65045399-65045421 GAGGGGGGAAGACGGGGGGTGGG - Intronic
1118694914 14:68375236-68375258 GAGCGGGGAAGGAGGGTGTTAGG - Intronic
1121304717 14:92898891-92898913 TAGCTGGGAAGGCTGGAGGTGGG - Intergenic
1121678196 14:95771456-95771478 CAGTGGGGAAGGGGGCAGGTAGG + Intergenic
1122112260 14:99510674-99510696 CAGGGGGGACGGCAGGAGGTGGG - Exonic
1122925744 14:104898955-104898977 CTGTGAGCAAGGCGGGCGGTCGG - Intergenic
1125300750 15:38252180-38252202 CTCCGGGGAAAGCGGGCGGCCGG + Intergenic
1128372497 15:67050542-67050564 CAGAGGGGAAGGGGAGCGGGGGG + Intergenic
1128456399 15:67833957-67833979 CCGGGAGGAAGGCGGGCGGACGG - Exonic
1132684634 16:1157196-1157218 GAGCGAGGGAGGCGGGCTGTGGG + Intronic
1132933734 16:2471131-2471153 CAGCGGGGAAGGGGGCTGGGAGG - Intergenic
1136365007 16:29805977-29805999 GCGCGGGGAGGGCGGGCGGGGGG - Intergenic
1137655465 16:50154359-50154381 CAGCAGCGAAGGCAGGCCGTGGG - Intronic
1137721849 16:50632050-50632072 CTGCGGGGAGGTCGGGCTGTGGG + Intronic
1137956822 16:52839980-52840002 CAGCGGGGAAAGTCGGGGGTGGG - Intergenic
1139582186 16:67880263-67880285 CAGCAGGGAAGGTGGGTGGTGGG + Intronic
1139941490 16:70608876-70608898 CAGCGAGGAAGGCGGGGTGTGGG + Intronic
1140412499 16:74749359-74749381 CTGCGGGGAGGGCGAGGGGTGGG - Intronic
1140475821 16:75238803-75238825 CAGCGGGGCAGGCGGGGCGGAGG + Intronic
1141661420 16:85443687-85443709 CAGCAGGGAAGGCAGGTGGGTGG - Intergenic
1143410827 17:6707378-6707400 CAGCTGGGAAGGAGGGAGGCAGG - Intronic
1143514762 17:7414123-7414145 CCGCGGGGAAGGCTGGCAGAGGG + Intronic
1143539810 17:7562238-7562260 GAGCGGGGAAGCCGGGCGGACGG - Exonic
1143590692 17:7884748-7884770 CGGTGGGGGAGGCGGGCGGGCGG + Intronic
1144735635 17:17553898-17553920 CAGCGGGGAGGGAGGGCGAGTGG - Intronic
1145771283 17:27495018-27495040 CAGCTGGTAAGCCGGGCGGCTGG + Intronic
1146132555 17:30291720-30291742 CGGCGGGGAAGGCCGGGGGCTGG - Intronic
1148262123 17:46193129-46193151 CGGCCGGGAGGGCGGGCGGGCGG + Intronic
1149893684 17:60412395-60412417 TAGTGGGGAATGGGGGCGGTGGG + Intronic
1150455742 17:65305166-65305188 CTGCAGGGAAGGAGGGTGGTGGG + Intergenic
1150692611 17:67378374-67378396 CAGCGGGGGAGGGCGGCGCTGGG + Intronic
1151351484 17:73534593-73534615 CAGCAGGGAAGGCCGGTGGAGGG + Intronic
1151708469 17:75785206-75785228 GAGTGGGGAAGGCGGGAGCTCGG + Intronic
1151747906 17:76021613-76021635 GGGCGGGGAAGGGGGGAGGTGGG - Intronic
1152134595 17:78496451-78496473 CAGCGGGGGTGGTGGGCGGGGGG + Intronic
1152345433 17:79748164-79748186 TAGCGGGTAGGGCGGGCGGCGGG + Intergenic
1152801801 17:82334105-82334127 CCGCGGGGAGGGAGGGCGGGGGG + Intergenic
1152892730 17:82891721-82891743 CAGCAGGGATGGGGGGTGGTTGG + Intronic
1153900704 18:9614739-9614761 CAGCGGGAAAGGCGGGAGGCGGG - Intronic
1157279032 18:46333949-46333971 CAGCGGGGACCGCGGGCGCGCGG - Intronic
1157396550 18:47346265-47346287 CAGCAGGGATGGAGGGCTGTTGG + Intergenic
1157544931 18:48540359-48540381 CATGGGGGAGGGCGGGCGGGGGG + Intronic
1157588263 18:48818919-48818941 CAGCAGGGAAGGAGAGCTGTGGG + Intronic
1158018753 18:52815453-52815475 CAGGGGGGCAGGGGGGTGGTGGG - Intronic
1160880217 19:1316238-1316260 CAGAGGTGAGGACGGGCGGTGGG - Intergenic
1160930163 19:1566674-1566696 CTGCGGGGCGGGCGGGCGGGTGG - Intronic
1161028210 19:2046342-2046364 GAGCGGGGATGGCGGGCATTGGG - Intronic
1161065704 19:2236281-2236303 GAGCGGGGACGGCGGCCGGGAGG - Exonic
1161104442 19:2436557-2436579 CAGCCGTGAAGGCGGGAGGGCGG - Intronic
1161393517 19:4033209-4033231 CAGGGGGGAAGGCCGGCCGCAGG - Intronic
1161652361 19:5493086-5493108 CGGCGGGGAAGTCGGGCACTGGG + Intergenic
1161958069 19:7507136-7507158 CAGCGGGTAAGGGAGGCGGAGGG + Exonic
1161959533 19:7516155-7516177 CGGCGGGGCTGGCGGGCGGGGGG + Exonic
1162450273 19:10750104-10750126 CACTGGGGAAGGTGGGAGGTTGG + Intronic
1162697101 19:12484824-12484846 CCGCCGGGAAGGCGGGCGGAGGG - Intronic
1162954530 19:14090857-14090879 GAGGGAGGAAGGCGGGCGGCGGG - Intronic
1162959682 19:14118285-14118307 CAGCGGGGGAGGGGCGCGGCCGG + Intergenic
1162969059 19:14169415-14169437 CAGCGGGGAAGGGGGGTGGGAGG - Intronic
1163117326 19:15196290-15196312 CACCTGGGAGGGCGAGCGGTGGG - Intronic
1165837943 19:38770731-38770753 CAGCTGGGAATGCGGTCGGGCGG - Intergenic
1165841622 19:38791966-38791988 CAGCTGGGAATGCGGTCGGGCGG + Intergenic
1165900436 19:39167069-39167091 CAGCCTGGAGGGCGGGCGGCTGG - Intronic
1166347792 19:42177109-42177131 CAGCCGGGCGGGCGGGCGGCGGG - Intronic
1166375212 19:42324026-42324048 AGCCGCGGAAGGCGGGCGGTGGG - Intronic
1166762573 19:45234329-45234351 CGGCGGGGTAGGCGGGCGCCAGG + Intronic
1166960040 19:46491802-46491824 CAGTGGGGCAGGCGGGGTGTGGG - Exonic
1167002886 19:46756281-46756303 GAGCTGGGAAGGCGGGCGGCTGG + Exonic
1167470276 19:49671914-49671936 GAAGGGGGAAGGAGGGCGGTGGG - Intronic
1167636975 19:50660927-50660949 CAAGAGGGAAGGCGGGGGGTGGG + Intronic
1168148294 19:54431421-54431443 CAGCGGGGAGTGCGGGAGTTGGG - Intronic
1168402150 19:56091598-56091620 GAGTGGGGAAGGCAGGAGGTGGG + Intronic
1168651163 19:58093195-58093217 CAGTGGGGGAGGCGGTCAGTAGG - Intronic
924998496 2:385445-385467 CAGGGGGGACGGAGGGTGGTAGG - Intergenic
925233946 2:2261098-2261120 CAGCAGGGAGGAAGGGCGGTAGG - Intronic
927596651 2:24403208-24403230 CTGGGGGGAGGGCGGGCGGGGGG - Intergenic
930136068 2:47905448-47905470 TGCCCGGGAAGGCGGGCGGTTGG + Intronic
931253231 2:60551230-60551252 CGCCTGGAAAGGCGGGCGGTGGG - Intronic
933858586 2:86441934-86441956 CAGCAGGGAGGGCGGGCGGAGGG - Intronic
934113794 2:88765511-88765533 CAGTGGCGAAGTCGGGCTGTGGG + Intergenic
935448337 2:103180315-103180337 CAGAGGGGAAGCCGGGAGGAGGG + Intergenic
936037965 2:109128196-109128218 CAGCAGGGAAGTTTGGCGGTGGG - Intergenic
936463631 2:112728599-112728621 CAGCAGGGAAGGCAGGCGACAGG - Intronic
937737675 2:125312458-125312480 CAGCGGGGAAGGCGTGCCCCGGG + Intergenic
937869350 2:126776652-126776674 CAGCGGGGAAAGCGGGCAAGGGG + Intergenic
940775221 2:157876768-157876790 GCGCGGGGCAGGCGGGCGGACGG + Intronic
942276728 2:174328544-174328566 GGGCAGGGAAGGCGGGCGGGCGG + Intergenic
947576696 2:231280972-231280994 CAGTGCCGAAGGAGGGCGGTGGG + Intronic
948190044 2:236051497-236051519 CAGGTGGGAAGGCGGGCTGGAGG + Intronic
948479253 2:238239941-238239963 CAGCGGGGACGGGGAGCGGCGGG + Exonic
948560613 2:238848872-238848894 TAGCAAGGAAGGCGGGCGGGCGG + Intronic
948577813 2:238965529-238965551 CAGGGAGGAAGGAGGCCGGTGGG - Intergenic
948824801 2:240568937-240568959 CCTCGGGGAAGGCGGGCAGCGGG - Exonic
948912628 2:241011992-241012014 GAGCGGGGCAGGCGGCGGGTGGG + Intronic
1169673726 20:8132190-8132212 TGGCGGGGAAGGGGGGCGGGGGG + Intronic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1172178697 20:32987636-32987658 CAGGGGGGATGGCGGGAGATGGG - Intronic
1173279794 20:41618155-41618177 GAGCGGGGCCGGCGGGCGGGCGG - Intronic
1173447710 20:43134976-43134998 CAGCTGGGAATGGTGGCGGTGGG - Intronic
1174283100 20:49453420-49453442 CAGCGGGGAATGCCAGCAGTTGG + Intronic
1174361194 20:50029851-50029873 CCACGGGGAAGGCTGGCCGTGGG - Intergenic
1175927006 20:62475930-62475952 CAGCGGGCAGGGAGGGCGGCAGG + Exonic
1176128001 20:63484501-63484523 CAGTGGGGAAGGCGAGGGGTGGG - Intergenic
1176366118 21:6033928-6033950 CTCCGGGGCAGGCGGGCGGATGG + Intergenic
1176675464 21:9773039-9773061 CAGCAGGGCAGGCTGGCGATGGG - Intergenic
1179726468 21:43343987-43344009 CAGCGGGGGAGGCAGCCGGAGGG - Intergenic
1179757399 21:43504617-43504639 CTCCGGGGCAGGCGGGCGGATGG - Intergenic
1180048888 21:45322343-45322365 TAGCGGGCAAGGAGGGCTGTTGG + Intergenic
1183432431 22:37773818-37773840 CAGGAGGGAAGGAGGGCGGCTGG - Exonic
1183547085 22:38460170-38460192 CAGCGGGAAAGGTTGGCGGAGGG - Intergenic
1184663784 22:45977219-45977241 GAGCGAGGAGGGCGGGCGGGAGG - Intergenic
1184785446 22:46669377-46669399 CGGCGGGGAAGGAGGGTGGCTGG + Intronic
1185058605 22:48593817-48593839 CAGCAGGGCAGGAGGGCGGCAGG - Intronic
949709825 3:6860986-6861008 CAGTGGGGAGGGCTGGCGCTGGG + Intronic
950215249 3:11154385-11154407 CAGCGGGGAAGGCGGGGACCCGG - Intronic
956195610 3:66651098-66651120 CAGCGGGGATGGCGGGGGGGGGG + Intergenic
960638975 3:119809558-119809580 CGGGGGGGAAGGCGGGGGGGTGG + Intronic
960747795 3:120908735-120908757 CAGCGGGGAGAGCGGACGGCGGG + Intronic
961635294 3:128329409-128329431 CAGCGGGGGTGGGGGGGGGTGGG - Intronic
963160914 3:142149749-142149771 CGGCGGGGAAGCGGGGTGGTCGG - Intergenic
963503873 3:146161104-146161126 CGGCGGGCAAGGCGCGCGGCCGG + Exonic
965757356 3:172040109-172040131 CTGCTGGGAAGGCTGGGGGTGGG - Intronic
966711931 3:182980450-182980472 CAGCCGGCAGGGCGGGCGGGCGG + Intronic
966912391 3:184566708-184566730 CAGCGGGGCAGGAGGGCAGGGGG - Intronic
966944132 3:184765774-184765796 CAGCGAGGGAGGAGGGAGGTAGG + Intergenic
968005197 3:195237962-195237984 CAGTGGGGAAGGTAGGAGGTAGG - Intronic
968066368 3:195761787-195761809 CAGCGGTGGAGGAGGGCGGGAGG + Intronic
968090555 3:195895940-195895962 CTGCGCGGGAGGCGGGCGCTGGG - Intronic
968584144 4:1408121-1408143 CAGCGGGGAGGGCGGGGGAGGGG - Intergenic
968586052 4:1416529-1416551 CAGCAGGGAGGCCGTGCGGTGGG - Intergenic
968870969 4:3242058-3242080 CTGCGGGGGAGGCGGGAGGCGGG - Exonic
968902789 4:3439177-3439199 CAGTGGGGAAGCAGGGTGGTAGG + Intronic
969056800 4:4407388-4407410 GAGATGGGAGGGCGGGCGGTGGG + Intronic
969413527 4:7044238-7044260 CACCAGGGAAGGAGAGCGGTGGG + Intronic
970192472 4:13529304-13529326 CGGCGGGGAAGGAGGACCGTCGG + Intergenic
973888446 4:55346311-55346333 CAGCGCGGAAGGCGGGCACGCGG + Exonic
975670465 4:76775102-76775124 CAGCGGGAAGGGTGGGAGGTGGG - Intronic
980086293 4:128393655-128393677 CAGCAGGGAGGGAGAGCGGTGGG + Intergenic
984973500 4:185210186-185210208 CGGCGGCGAAGTCGGGCGGCTGG - Intronic
985081286 4:186266868-186266890 CGGCGGGGAAGGAGGGAGGAGGG + Intronic
985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG + Intronic
985644355 5:1078015-1078037 CAGGCGGGCAGGCGGGCGGGCGG + Intronic
986142940 5:5048789-5048811 GAGCTGGGAAGGTGGGCAGTGGG - Intergenic
987035500 5:14014612-14014634 CAGTATGGAAGGTGGGCGGTGGG + Intergenic
988264072 5:28927925-28927947 CAGTGGCGAAGTCGGGCTGTGGG - Intergenic
988456379 5:31390597-31390619 CAGAGGGGAAGGGGTGGGGTGGG + Intergenic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
989146880 5:38258323-38258345 CAGCGGGGAAGGGCTGCGCTGGG + Intergenic
993385042 5:87252549-87252571 GAGCGGGGAGGGCGGAAGGTGGG + Intergenic
996038805 5:118787721-118787743 CAGTGTGGAAGGAGGGTGGTTGG + Intergenic
996398430 5:123035825-123035847 CTGCGGGGAAAGGGGGCGGGGGG - Intronic
997233144 5:132257994-132258016 CAGCGTGGGAGGAGGGCGGCTGG - Intronic
997260893 5:132464863-132464885 ATGCGGGGAAGGAGGGCAGTCGG + Exonic
997649830 5:135508152-135508174 AAGAGGGGAAGGAGGGCGGGAGG + Intergenic
998467937 5:142360859-142360881 CAGCAGGGAGAGCGGGCAGTTGG - Intergenic
1001831757 5:174794888-174794910 CAGGGGGGACGGGGGGGGGTGGG - Intergenic
1001940359 5:175735853-175735875 AAGCTGGGTGGGCGGGCGGTGGG - Intergenic
1002281995 5:178136420-178136442 CAGAGGGGATGGTGGGGGGTGGG + Intronic
1003504456 6:6728313-6728335 CAGCGGGGAAGGCAGCCTGTGGG - Intergenic
1003976168 6:11346628-11346650 CATCGGGGAAGGAGGGGGCTGGG + Intronic
1004803645 6:19178572-19178594 CACGGGGGAGGGGGGGCGGTGGG + Intergenic
1006271215 6:32968802-32968824 CTGGGGGAAAGGCGGGGGGTGGG + Intronic
1007733302 6:43964970-43964992 CAGCAGGGAAGGTGGGGGGTGGG + Intergenic
1007784251 6:44270933-44270955 CAGCGGGGGACGCGTGCGATGGG - Intronic
1011313996 6:86011058-86011080 TAGCGGGGAATGTGGGTGGTGGG + Intergenic
1011314531 6:86016798-86016820 CAGGGAGGAAGGGGGGCGGTGGG + Intergenic
1012889800 6:104885414-104885436 CAGCGGGGAAGGCGTGCCCGGGG + Intergenic
1017158366 6:151342085-151342107 CAGCTGGGGAGGTGGGCGGCAGG + Intronic
1017804853 6:157935792-157935814 CAGTGGGGAAGGCAGATGGTGGG + Intronic
1019575621 7:1736288-1736310 CAGGGGGAAAGGTGGGCGGAGGG - Intronic
1020153635 7:5703378-5703400 CAGCTGTGATGGCGGGTGGTTGG - Intronic
1020234985 7:6348514-6348536 CCGCGGGCGAGGCGGGCGCTCGG + Intronic
1020461768 7:8435404-8435426 CAGCTGGGGAGGCGGGCGGGCGG - Intronic
1021862821 7:24923731-24923753 CAGTGGGGCAGGCGGGCGGCCGG + Intronic
1022205473 7:28159461-28159483 CAGAGAGGAAGGCGGGAGGTGGG + Intronic
1022722979 7:32957416-32957438 CGGCCGGGAGGGCGGGCGGCCGG + Exonic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023258483 7:38335505-38335527 CAGAGAGGAAGGCATGCGGTGGG - Intergenic
1023262020 7:38368046-38368068 CAGAGAGGAAGGCATGCGGTGGG - Intergenic
1023558042 7:41443643-41443665 CAGTGAGGAAGGAGGGTGGTGGG + Intergenic
1023819613 7:43973244-43973266 CAGCGTGGAAGGTGGGCGGCAGG + Intergenic
1023966207 7:44964234-44964256 CAGCGGGGAGGGGAGGCAGTAGG - Intronic
1024215875 7:47247699-47247721 CAGCAGGGAAGGGGAGCCGTGGG - Intergenic
1024254724 7:47532067-47532089 CAGCAGGGATGGTGGGCGGGGGG - Intronic
1025205603 7:56991935-56991957 CAGAGGGCAAGGCGGGAGCTTGG - Intergenic
1025666337 7:63585003-63585025 CAGAGGGCAAGGCGGGAGCTTGG + Intergenic
1027138180 7:75639157-75639179 CTGCGGGGAGGGCGGCCGGCAGG + Intronic
1029347972 7:99992599-99992621 CAGCGGGGAGAGCGGGTGGAAGG - Intergenic
1029744664 7:102510213-102510235 CAGCGTGGAAGGTGGGCGGCAGG + Exonic
1029762655 7:102609375-102609397 CAGCGTGGAAGGTGGGCGGCAGG + Exonic
1031992320 7:128206457-128206479 CAGCGCGGAAAGCTGGCTGTGGG + Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1036432161 8:8701854-8701876 CGCCGGGCCAGGCGGGCGGTGGG - Intergenic
1038575628 8:28701558-28701580 CGGCCTGGAAGGCGGGCGGCCGG + Exonic
1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG + Exonic
1044306410 8:90645760-90645782 CCGCGGGGAAGGCGGTCCGCCGG + Exonic
1048554015 8:135457728-135457750 CAGCGGCCAAGCCGGGCGGTCGG - Exonic
1049237333 8:141518786-141518808 CGGCGGGGAAGGGGGGCGGTGGG + Intergenic
1049414013 8:142487274-142487296 CAGCGGGGAATGGGGGCAGACGG - Intronic
1049541635 8:143211565-143211587 CAGTGGGGGAGGCGGGGCGTGGG + Intergenic
1049541660 8:143211616-143211638 CAGTGGGGGAGGCGGGGCGTGGG + Intergenic
1049541693 8:143211684-143211706 CAGTGGGGGAGGCGGGGCGTGGG + Intergenic
1049604227 8:143521583-143521605 CACCGGGGCAGGCAGGAGGTGGG + Intronic
1049710401 8:144060606-144060628 CAGCGGGGAAGGGCCGCGGAGGG + Intronic
1053010234 9:34628798-34628820 TCGCGGGGATGGAGGGCGGTGGG + Intergenic
1053417081 9:37953575-37953597 CAGGAGGGAAGGCAGGTGGTAGG + Intronic
1054812213 9:69443991-69444013 CAGTGGGGAAGCCAGGGGGTGGG - Intronic
1055577529 9:77674997-77675019 CATCGGGGTGGGCGGGGGGTAGG + Intergenic
1056350243 9:85741990-85742012 CGGCTGGCAAGGCGTGCGGTGGG - Intronic
1056671299 9:88629692-88629714 CAGCGGGGAAGGCTGGAAGGGGG - Intergenic
1056812023 9:89772312-89772334 GAGCGGGGAAGGTGGTGGGTGGG + Intergenic
1059208318 9:112486949-112486971 GAGCGGGGAAGGCGCCCGGCGGG - Exonic
1059660371 9:116394179-116394201 AAGTGTGGAAGGTGGGCGGTGGG + Intronic
1060770256 9:126327058-126327080 CAGCCGGGAGGGCGGGCGGGCGG + Intronic
1060810905 9:126611137-126611159 CAGCGGGGAAGGCATGCAGAGGG + Intergenic
1061089953 9:128420865-128420887 CAGCGCGCATGGCGGGCGCTTGG - Exonic
1061160834 9:128892851-128892873 CAGGAGGGGAGGCGGGAGGTTGG - Intronic
1062010894 9:134266130-134266152 CAGCAGGGAAGGCGGGCAAGGGG + Intergenic
1062266675 9:135689716-135689738 GAGAGGGGGAGGCTGGCGGTGGG - Intergenic
1062332544 9:136051024-136051046 CAGCGGGGAAGGAGGGAGGGAGG + Intronic
1062567011 9:137167964-137167986 CAGCGGGGTGGGCGGGCGGACGG - Exonic
1062614833 9:137391573-137391595 CACCAGGGCCGGCGGGCGGTGGG - Intronic
1062615924 9:137395636-137395658 CAGCAGGGAGGGCAGGGGGTGGG + Intronic
1186345175 X:8684651-8684673 CCTCGGGGAAGGCGGGGGGTGGG - Intronic
1187154726 X:16712352-16712374 CACCGGGGAGGGTGGCCGGTGGG + Intronic
1187163817 X:16786808-16786830 CGGCGGGGAAGCCGGGAGGGAGG + Intronic
1190298475 X:49042456-49042478 CAGCTGGGTAGGCGGGCAGAGGG + Intronic
1192274819 X:69617397-69617419 AAGCGGGGTAGGTGTGCGGTGGG + Intronic
1192436812 X:71148237-71148259 CAGCAGGGCAGGCGGGAGGCAGG - Intronic
1195306125 X:103585690-103585712 CAGGGGGAAAGGCTGGGGGTGGG + Intronic
1199745772 X:150771260-150771282 CACCGGGGCAGGCAGGTGGTGGG - Intronic
1199832942 X:151562808-151562830 CAGCGGGGGGGGCGGGGGGTGGG + Intergenic
1200243167 X:154508243-154508265 GAGCAGGGAAGGAGGGCGGCAGG + Intronic
1200684366 Y:6246092-6246114 GGGCAGGGAAGGCGGGGGGTGGG + Intergenic
1200687009 Y:6266416-6266438 GGGCAGGGAAGGCGGGGGGTGGG + Intergenic
1200992556 Y:9357666-9357688 GGGCAGGGAAGGCGGGGGGTGGG + Intergenic
1200997873 Y:9398290-9398312 GGGCAGGGAAGGCGGGGGGTGGG + Intergenic
1201003044 Y:9487136-9487158 GGGCAGGGAAGGCGGGGGGTGGG + Intronic
1201005703 Y:9507419-9507441 GGGCAGGGAAGGCGGGGGGTGGG + Intergenic
1201008363 Y:9527749-9527771 GGGCAGGGAAGGCGGGGGGTGGG + Intergenic
1201048268 Y:9908294-9908316 GGGCAGGGAAGGCGGGGGGTGGG - Intergenic