ID: 901737542

View in Genome Browser
Species Human (GRCh38)
Location 1:11321998-11322020
Sequence CAGGCTCAGCAGAAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901737542_901737552 16 Left 901737542 1:11321998-11322020 CCTCCATCCTTCTGCTGAGCCTG No data
Right 901737552 1:11322037-11322059 CCTCCTGCACCAGCCAGCTGTGG No data
901737542_901737558 30 Left 901737542 1:11321998-11322020 CCTCCATCCTTCTGCTGAGCCTG No data
Right 901737558 1:11322051-11322073 CAGCTGTGGGGAGATCACCCAGG No data
901737542_901737554 18 Left 901737542 1:11321998-11322020 CCTCCATCCTTCTGCTGAGCCTG No data
Right 901737554 1:11322039-11322061 TCCTGCACCAGCCAGCTGTGGGG No data
901737542_901737553 17 Left 901737542 1:11321998-11322020 CCTCCATCCTTCTGCTGAGCCTG No data
Right 901737553 1:11322038-11322060 CTCCTGCACCAGCCAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901737542 Original CRISPR CAGGCTCAGCAGAAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr