ID: 901737959

View in Genome Browser
Species Human (GRCh38)
Location 1:11324217-11324239
Sequence GAGGCTGGTCGCATCTTGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901737953_901737959 5 Left 901737953 1:11324189-11324211 CCCGCCTTGCCATTAGATGTCTG No data
Right 901737959 1:11324217-11324239 GAGGCTGGTCGCATCTTGCTCGG No data
901737955_901737959 1 Left 901737955 1:11324193-11324215 CCTTGCCATTAGATGTCTGTGAC No data
Right 901737959 1:11324217-11324239 GAGGCTGGTCGCATCTTGCTCGG No data
901737948_901737959 22 Left 901737948 1:11324172-11324194 CCCTAGGAACCACAGCCCCCGCC No data
Right 901737959 1:11324217-11324239 GAGGCTGGTCGCATCTTGCTCGG No data
901737951_901737959 7 Left 901737951 1:11324187-11324209 CCCCCGCCTTGCCATTAGATGTC No data
Right 901737959 1:11324217-11324239 GAGGCTGGTCGCATCTTGCTCGG No data
901737952_901737959 6 Left 901737952 1:11324188-11324210 CCCCGCCTTGCCATTAGATGTCT No data
Right 901737959 1:11324217-11324239 GAGGCTGGTCGCATCTTGCTCGG No data
901737949_901737959 21 Left 901737949 1:11324173-11324195 CCTAGGAACCACAGCCCCCGCCT No data
Right 901737959 1:11324217-11324239 GAGGCTGGTCGCATCTTGCTCGG No data
901737954_901737959 4 Left 901737954 1:11324190-11324212 CCGCCTTGCCATTAGATGTCTGT No data
Right 901737959 1:11324217-11324239 GAGGCTGGTCGCATCTTGCTCGG No data
901737950_901737959 13 Left 901737950 1:11324181-11324203 CCACAGCCCCCGCCTTGCCATTA No data
Right 901737959 1:11324217-11324239 GAGGCTGGTCGCATCTTGCTCGG No data
901737956_901737959 -4 Left 901737956 1:11324198-11324220 CCATTAGATGTCTGTGACTGAGG No data
Right 901737959 1:11324217-11324239 GAGGCTGGTCGCATCTTGCTCGG No data
901737947_901737959 25 Left 901737947 1:11324169-11324191 CCACCCTAGGAACCACAGCCCCC No data
Right 901737959 1:11324217-11324239 GAGGCTGGTCGCATCTTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901737959 Original CRISPR GAGGCTGGTCGCATCTTGCT CGG Intergenic
No off target data available for this crispr