ID: 901739735

View in Genome Browser
Species Human (GRCh38)
Location 1:11334420-11334442
Sequence CCTGTAGGGTCCACCCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901739735_901739748 18 Left 901739735 1:11334420-11334442 CCCGGCTGGGTGGACCCTACAGG No data
Right 901739748 1:11334461-11334483 CCTTACCCCTCCCCTTGTCTGGG No data
901739735_901739746 17 Left 901739735 1:11334420-11334442 CCCGGCTGGGTGGACCCTACAGG No data
Right 901739746 1:11334460-11334482 CCCTTACCCCTCCCCTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901739735 Original CRISPR CCTGTAGGGTCCACCCAGCC GGG (reversed) Intergenic