ID: 901740899

View in Genome Browser
Species Human (GRCh38)
Location 1:11341123-11341145
Sequence TGTGTTGAATGATTAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901740899_901740908 24 Left 901740899 1:11341123-11341145 CCCTCACTTAATCATTCAACACA No data
Right 901740908 1:11341170-11341192 CCAGACCGCATCCCAGGCTCTGG No data
901740899_901740910 26 Left 901740899 1:11341123-11341145 CCCTCACTTAATCATTCAACACA No data
Right 901740910 1:11341172-11341194 AGACCGCATCCCAGGCTCTGGGG No data
901740899_901740909 25 Left 901740899 1:11341123-11341145 CCCTCACTTAATCATTCAACACA No data
Right 901740909 1:11341171-11341193 CAGACCGCATCCCAGGCTCTGGG No data
901740899_901740906 18 Left 901740899 1:11341123-11341145 CCCTCACTTAATCATTCAACACA No data
Right 901740906 1:11341164-11341186 CATGTGCCAGACCGCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901740899 Original CRISPR TGTGTTGAATGATTAAGTGA GGG (reversed) Intergenic
No off target data available for this crispr