ID: 901740902

View in Genome Browser
Species Human (GRCh38)
Location 1:11341148-11341170
Sequence GCACATGATTGGGGCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901740902_901740908 -1 Left 901740902 1:11341148-11341170 CCTGGAGAGCCCCAATCATGTGC No data
Right 901740908 1:11341170-11341192 CCAGACCGCATCCCAGGCTCTGG No data
901740902_901740909 0 Left 901740902 1:11341148-11341170 CCTGGAGAGCCCCAATCATGTGC No data
Right 901740909 1:11341171-11341193 CAGACCGCATCCCAGGCTCTGGG No data
901740902_901740906 -7 Left 901740902 1:11341148-11341170 CCTGGAGAGCCCCAATCATGTGC No data
Right 901740906 1:11341164-11341186 CATGTGCCAGACCGCATCCCAGG No data
901740902_901740910 1 Left 901740902 1:11341148-11341170 CCTGGAGAGCCCCAATCATGTGC No data
Right 901740910 1:11341172-11341194 AGACCGCATCCCAGGCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901740902 Original CRISPR GCACATGATTGGGGCTCTCC AGG (reversed) Intergenic
No off target data available for this crispr