ID: 901740904

View in Genome Browser
Species Human (GRCh38)
Location 1:11341158-11341180
Sequence ATGCGGTCTGGCACATGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901740904_901740910 -9 Left 901740904 1:11341158-11341180 CCCAATCATGTGCCAGACCGCAT No data
Right 901740910 1:11341172-11341194 AGACCGCATCCCAGGCTCTGGGG No data
901740904_901740909 -10 Left 901740904 1:11341158-11341180 CCCAATCATGTGCCAGACCGCAT No data
Right 901740909 1:11341171-11341193 CAGACCGCATCCCAGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901740904 Original CRISPR ATGCGGTCTGGCACATGATT GGG (reversed) Intergenic
No off target data available for this crispr