ID: 901740909

View in Genome Browser
Species Human (GRCh38)
Location 1:11341171-11341193
Sequence CAGACCGCATCCCAGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901740903_901740909 -9 Left 901740903 1:11341157-11341179 CCCCAATCATGTGCCAGACCGCA No data
Right 901740909 1:11341171-11341193 CAGACCGCATCCCAGGCTCTGGG No data
901740900_901740909 24 Left 901740900 1:11341124-11341146 CCTCACTTAATCATTCAACACAC No data
Right 901740909 1:11341171-11341193 CAGACCGCATCCCAGGCTCTGGG No data
901740902_901740909 0 Left 901740902 1:11341148-11341170 CCTGGAGAGCCCCAATCATGTGC No data
Right 901740909 1:11341171-11341193 CAGACCGCATCCCAGGCTCTGGG No data
901740899_901740909 25 Left 901740899 1:11341123-11341145 CCCTCACTTAATCATTCAACACA No data
Right 901740909 1:11341171-11341193 CAGACCGCATCCCAGGCTCTGGG No data
901740898_901740909 30 Left 901740898 1:11341118-11341140 CCTAACCCTCACTTAATCATTCA No data
Right 901740909 1:11341171-11341193 CAGACCGCATCCCAGGCTCTGGG No data
901740904_901740909 -10 Left 901740904 1:11341158-11341180 CCCAATCATGTGCCAGACCGCAT No data
Right 901740909 1:11341171-11341193 CAGACCGCATCCCAGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901740909 Original CRISPR CAGACCGCATCCCAGGCTCT GGG Intergenic
No off target data available for this crispr