ID: 901746087

View in Genome Browser
Species Human (GRCh38)
Location 1:11374692-11374714
Sequence GACTGACTCATTGTCCCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901746081_901746087 9 Left 901746081 1:11374660-11374682 CCCTCTGCCTGACCTAACTGCAG No data
Right 901746087 1:11374692-11374714 GACTGACTCATTGTCCCCCCGGG No data
901746083_901746087 2 Left 901746083 1:11374667-11374689 CCTGACCTAACTGCAGTGTTCAC No data
Right 901746087 1:11374692-11374714 GACTGACTCATTGTCCCCCCGGG No data
901746082_901746087 8 Left 901746082 1:11374661-11374683 CCTCTGCCTGACCTAACTGCAGT No data
Right 901746087 1:11374692-11374714 GACTGACTCATTGTCCCCCCGGG No data
901746085_901746087 -3 Left 901746085 1:11374672-11374694 CCTAACTGCAGTGTTCACAGGAC No data
Right 901746087 1:11374692-11374714 GACTGACTCATTGTCCCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901746087 Original CRISPR GACTGACTCATTGTCCCCCC GGG Intergenic
No off target data available for this crispr