ID: 901748298

View in Genome Browser
Species Human (GRCh38)
Location 1:11389233-11389255
Sequence TTCCTTAGGGCCCCTCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901748293_901748298 -6 Left 901748293 1:11389216-11389238 CCATCCTGAATGTCACGTTCCTT No data
Right 901748298 1:11389233-11389255 TTCCTTAGGGCCCCTCTGATGGG No data
901748295_901748298 -10 Left 901748295 1:11389220-11389242 CCTGAATGTCACGTTCCTTAGGG No data
Right 901748298 1:11389233-11389255 TTCCTTAGGGCCCCTCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901748298 Original CRISPR TTCCTTAGGGCCCCTCTGAT GGG Intergenic
No off target data available for this crispr