ID: 901748673

View in Genome Browser
Species Human (GRCh38)
Location 1:11392141-11392163
Sequence AGAGAGGAGCAGAATGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901748673_901748679 5 Left 901748673 1:11392141-11392163 CCTTCTTCATTCTGCTCCTCTCT No data
Right 901748679 1:11392169-11392191 AGCTGACAGCAATGGGGCTTTGG No data
901748673_901748676 -2 Left 901748673 1:11392141-11392163 CCTTCTTCATTCTGCTCCTCTCT No data
Right 901748676 1:11392162-11392184 CTGAACCAGCTGACAGCAATGGG No data
901748673_901748680 6 Left 901748673 1:11392141-11392163 CCTTCTTCATTCTGCTCCTCTCT No data
Right 901748680 1:11392170-11392192 GCTGACAGCAATGGGGCTTTGGG No data
901748673_901748682 23 Left 901748673 1:11392141-11392163 CCTTCTTCATTCTGCTCCTCTCT No data
Right 901748682 1:11392187-11392209 TTTGGGGCAGAGACACAAGACGG No data
901748673_901748677 -1 Left 901748673 1:11392141-11392163 CCTTCTTCATTCTGCTCCTCTCT No data
Right 901748677 1:11392163-11392185 TGAACCAGCTGACAGCAATGGGG No data
901748673_901748675 -3 Left 901748673 1:11392141-11392163 CCTTCTTCATTCTGCTCCTCTCT No data
Right 901748675 1:11392161-11392183 TCTGAACCAGCTGACAGCAATGG No data
901748673_901748685 30 Left 901748673 1:11392141-11392163 CCTTCTTCATTCTGCTCCTCTCT No data
Right 901748685 1:11392194-11392216 CAGAGACACAAGACGGGGAGCGG No data
901748673_901748683 24 Left 901748673 1:11392141-11392163 CCTTCTTCATTCTGCTCCTCTCT No data
Right 901748683 1:11392188-11392210 TTGGGGCAGAGACACAAGACGGG No data
901748673_901748681 7 Left 901748673 1:11392141-11392163 CCTTCTTCATTCTGCTCCTCTCT No data
Right 901748681 1:11392171-11392193 CTGACAGCAATGGGGCTTTGGGG No data
901748673_901748684 25 Left 901748673 1:11392141-11392163 CCTTCTTCATTCTGCTCCTCTCT No data
Right 901748684 1:11392189-11392211 TGGGGCAGAGACACAAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901748673 Original CRISPR AGAGAGGAGCAGAATGAAGA AGG (reversed) Intergenic
No off target data available for this crispr