ID: 901749048

View in Genome Browser
Species Human (GRCh38)
Location 1:11394702-11394724
Sequence AGACTACTATAGATGGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901749048_901749052 -6 Left 901749048 1:11394702-11394724 CCAAAACCCATCTATAGTAGTCT No data
Right 901749052 1:11394719-11394741 TAGTCTCTCCTTATCTGTGGAGG No data
901749048_901749054 16 Left 901749048 1:11394702-11394724 CCAAAACCCATCTATAGTAGTCT No data
Right 901749054 1:11394741-11394763 GACACGTTCCAAGACCTCAGTGG No data
901749048_901749051 -9 Left 901749048 1:11394702-11394724 CCAAAACCCATCTATAGTAGTCT No data
Right 901749051 1:11394716-11394738 TAGTAGTCTCTCCTTATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901749048 Original CRISPR AGACTACTATAGATGGGTTT TGG (reversed) Intergenic