ID: 901749049

View in Genome Browser
Species Human (GRCh38)
Location 1:11394708-11394730
Sequence AAGGAGAGACTACTATAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901749049_901749054 10 Left 901749049 1:11394708-11394730 CCCATCTATAGTAGTCTCTCCTT No data
Right 901749054 1:11394741-11394763 GACACGTTCCAAGACCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901749049 Original CRISPR AAGGAGAGACTACTATAGAT GGG (reversed) Intergenic
No off target data available for this crispr