ID: 901749050

View in Genome Browser
Species Human (GRCh38)
Location 1:11394709-11394731
Sequence TAAGGAGAGACTACTATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901749050_901749054 9 Left 901749050 1:11394709-11394731 CCATCTATAGTAGTCTCTCCTTA No data
Right 901749054 1:11394741-11394763 GACACGTTCCAAGACCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901749050 Original CRISPR TAAGGAGAGACTACTATAGA TGG (reversed) Intergenic
No off target data available for this crispr