ID: 901749054

View in Genome Browser
Species Human (GRCh38)
Location 1:11394741-11394763
Sequence GACACGTTCCAAGACCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901749049_901749054 10 Left 901749049 1:11394708-11394730 CCCATCTATAGTAGTCTCTCCTT No data
Right 901749054 1:11394741-11394763 GACACGTTCCAAGACCTCAGTGG No data
901749048_901749054 16 Left 901749048 1:11394702-11394724 CCAAAACCCATCTATAGTAGTCT No data
Right 901749054 1:11394741-11394763 GACACGTTCCAAGACCTCAGTGG No data
901749053_901749054 -9 Left 901749053 1:11394727-11394749 CCTTATCTGTGGAGGACACGTTC No data
Right 901749054 1:11394741-11394763 GACACGTTCCAAGACCTCAGTGG No data
901749050_901749054 9 Left 901749050 1:11394709-11394731 CCATCTATAGTAGTCTCTCCTTA No data
Right 901749054 1:11394741-11394763 GACACGTTCCAAGACCTCAGTGG No data
901749046_901749054 28 Left 901749046 1:11394690-11394712 CCATTTGTCTACCCAAAACCCAT No data
Right 901749054 1:11394741-11394763 GACACGTTCCAAGACCTCAGTGG No data
901749047_901749054 17 Left 901749047 1:11394701-11394723 CCCAAAACCCATCTATAGTAGTC No data
Right 901749054 1:11394741-11394763 GACACGTTCCAAGACCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901749054 Original CRISPR GACACGTTCCAAGACCTCAG TGG Intergenic
No off target data available for this crispr