ID: 901752888

View in Genome Browser
Species Human (GRCh38)
Location 1:11422427-11422449
Sequence AGGGCCCACTTGCTGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901752888_901752896 7 Left 901752888 1:11422427-11422449 CCCCAAGACAGCAAGTGGGCCCT No data
Right 901752896 1:11422457-11422479 AAGGGATTCTCCATTTTCCCAGG No data
901752888_901752897 8 Left 901752888 1:11422427-11422449 CCCCAAGACAGCAAGTGGGCCCT No data
Right 901752897 1:11422458-11422480 AGGGATTCTCCATTTTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901752888 Original CRISPR AGGGCCCACTTGCTGTCTTG GGG (reversed) Intergenic
No off target data available for this crispr