ID: 901755204

View in Genome Browser
Species Human (GRCh38)
Location 1:11437299-11437321
Sequence CAGAGTAAGGTGGAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901755204_901755209 11 Left 901755204 1:11437299-11437321 CCTGCCTCTTCCACCTTACTCTG No data
Right 901755209 1:11437333-11437355 CTCCCCTATATCCCAGCCCCAGG No data
901755204_901755210 12 Left 901755204 1:11437299-11437321 CCTGCCTCTTCCACCTTACTCTG No data
Right 901755210 1:11437334-11437356 TCCCCTATATCCCAGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901755204 Original CRISPR CAGAGTAAGGTGGAAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr