ID: 901757445

View in Genome Browser
Species Human (GRCh38)
Location 1:11449865-11449887
Sequence TCTTCCCTCCTGCACAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901757445_901757447 1 Left 901757445 1:11449865-11449887 CCTCACTTGTGCAGGAGGGAAGA No data
Right 901757447 1:11449889-11449911 TCACCCTGATCCTCTGCGACGGG No data
901757445_901757446 0 Left 901757445 1:11449865-11449887 CCTCACTTGTGCAGGAGGGAAGA No data
Right 901757446 1:11449888-11449910 ATCACCCTGATCCTCTGCGACGG No data
901757445_901757453 15 Left 901757445 1:11449865-11449887 CCTCACTTGTGCAGGAGGGAAGA No data
Right 901757453 1:11449903-11449925 TGCGACGGGAAAGAGACAAGGGG No data
901757445_901757456 25 Left 901757445 1:11449865-11449887 CCTCACTTGTGCAGGAGGGAAGA No data
Right 901757456 1:11449913-11449935 AAGAGACAAGGGGGACTGAAGGG No data
901757445_901757452 14 Left 901757445 1:11449865-11449887 CCTCACTTGTGCAGGAGGGAAGA No data
Right 901757452 1:11449902-11449924 CTGCGACGGGAAAGAGACAAGGG No data
901757445_901757455 24 Left 901757445 1:11449865-11449887 CCTCACTTGTGCAGGAGGGAAGA No data
Right 901757455 1:11449912-11449934 AAAGAGACAAGGGGGACTGAAGG No data
901757445_901757454 16 Left 901757445 1:11449865-11449887 CCTCACTTGTGCAGGAGGGAAGA No data
Right 901757454 1:11449904-11449926 GCGACGGGAAAGAGACAAGGGGG No data
901757445_901757451 13 Left 901757445 1:11449865-11449887 CCTCACTTGTGCAGGAGGGAAGA No data
Right 901757451 1:11449901-11449923 TCTGCGACGGGAAAGAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901757445 Original CRISPR TCTTCCCTCCTGCACAAGTG AGG (reversed) Intergenic
No off target data available for this crispr