ID: 901757451 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:11449901-11449923 |
| Sequence | TCTGCGACGGGAAAGAGACA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 901757445_901757451 | 13 | Left | 901757445 | 1:11449865-11449887 | CCTCACTTGTGCAGGAGGGAAGA | No data | ||
| Right | 901757451 | 1:11449901-11449923 | TCTGCGACGGGAAAGAGACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 901757451 | Original CRISPR | TCTGCGACGGGAAAGAGACA AGG | Intergenic | ||