ID: 901757452

View in Genome Browser
Species Human (GRCh38)
Location 1:11449902-11449924
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901757445_901757452 14 Left 901757445 1:11449865-11449887 CCTCACTTGTGCAGGAGGGAAGA No data
Right 901757452 1:11449902-11449924 CTGCGACGGGAAAGAGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr