ID: 901757456

View in Genome Browser
Species Human (GRCh38)
Location 1:11449913-11449935
Sequence AAGAGACAAGGGGGACTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901757448_901757456 -2 Left 901757448 1:11449892-11449914 CCCTGATCCTCTGCGACGGGAAA No data
Right 901757456 1:11449913-11449935 AAGAGACAAGGGGGACTGAAGGG No data
901757450_901757456 -9 Left 901757450 1:11449899-11449921 CCTCTGCGACGGGAAAGAGACAA No data
Right 901757456 1:11449913-11449935 AAGAGACAAGGGGGACTGAAGGG No data
901757449_901757456 -3 Left 901757449 1:11449893-11449915 CCTGATCCTCTGCGACGGGAAAG No data
Right 901757456 1:11449913-11449935 AAGAGACAAGGGGGACTGAAGGG No data
901757445_901757456 25 Left 901757445 1:11449865-11449887 CCTCACTTGTGCAGGAGGGAAGA No data
Right 901757456 1:11449913-11449935 AAGAGACAAGGGGGACTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901757456 Original CRISPR AAGAGACAAGGGGGACTGAA GGG Intergenic
No off target data available for this crispr