ID: 901758423

View in Genome Browser
Species Human (GRCh38)
Location 1:11455418-11455440
Sequence CTGAAGCCAGTGGTGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901758420_901758423 -4 Left 901758420 1:11455399-11455421 CCAGGGAGGTCTAGGCTTGCTGA No data
Right 901758423 1:11455418-11455440 CTGAAGCCAGTGGTGGAGCTTGG No data
901758413_901758423 23 Left 901758413 1:11455372-11455394 CCATTATATAGAGGGGGAAACTG No data
Right 901758423 1:11455418-11455440 CTGAAGCCAGTGGTGGAGCTTGG No data
901758419_901758423 -3 Left 901758419 1:11455398-11455420 CCCAGGGAGGTCTAGGCTTGCTG No data
Right 901758423 1:11455418-11455440 CTGAAGCCAGTGGTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901758423 Original CRISPR CTGAAGCCAGTGGTGGAGCT TGG Intergenic
No off target data available for this crispr