ID: 901759536

View in Genome Browser
Species Human (GRCh38)
Location 1:11461784-11461806
Sequence GGACACACACTGACATTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901759536_901759544 24 Left 901759536 1:11461784-11461806 CCCAGAAATGTCAGTGTGTGTCC No data
Right 901759544 1:11461831-11461853 GTTTTGCTGTGCTCCAGGGGAGG No data
901759536_901759543 21 Left 901759536 1:11461784-11461806 CCCAGAAATGTCAGTGTGTGTCC No data
Right 901759543 1:11461828-11461850 CGAGTTTTGCTGTGCTCCAGGGG No data
901759536_901759542 20 Left 901759536 1:11461784-11461806 CCCAGAAATGTCAGTGTGTGTCC No data
Right 901759542 1:11461827-11461849 TCGAGTTTTGCTGTGCTCCAGGG No data
901759536_901759546 26 Left 901759536 1:11461784-11461806 CCCAGAAATGTCAGTGTGTGTCC No data
Right 901759546 1:11461833-11461855 TTTGCTGTGCTCCAGGGGAGGGG No data
901759536_901759541 19 Left 901759536 1:11461784-11461806 CCCAGAAATGTCAGTGTGTGTCC No data
Right 901759541 1:11461826-11461848 ATCGAGTTTTGCTGTGCTCCAGG No data
901759536_901759545 25 Left 901759536 1:11461784-11461806 CCCAGAAATGTCAGTGTGTGTCC No data
Right 901759545 1:11461832-11461854 TTTTGCTGTGCTCCAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901759536 Original CRISPR GGACACACACTGACATTTCT GGG (reversed) Intergenic
No off target data available for this crispr