ID: 901761597

View in Genome Browser
Species Human (GRCh38)
Location 1:11475292-11475314
Sequence GAACAGAGCTTCAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901761590_901761597 5 Left 901761590 1:11475264-11475286 CCCAACCATAAGCTCATGCTCAT No data
Right 901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG No data
901761591_901761597 4 Left 901761591 1:11475265-11475287 CCAACCATAAGCTCATGCTCATC No data
Right 901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG No data
901761588_901761597 19 Left 901761588 1:11475250-11475272 CCTCTAATGTTTTCCCCAACCAT No data
Right 901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG No data
901761589_901761597 6 Left 901761589 1:11475263-11475285 CCCCAACCATAAGCTCATGCTCA No data
Right 901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG No data
901761592_901761597 0 Left 901761592 1:11475269-11475291 CCATAAGCTCATGCTCATCTCCT No data
Right 901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG No data
901761587_901761597 20 Left 901761587 1:11475249-11475271 CCCTCTAATGTTTTCCCCAACCA No data
Right 901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901761597 Original CRISPR GAACAGAGCTTCAGGGAGGA AGG Intergenic
No off target data available for this crispr