ID: 901762171

View in Genome Browser
Species Human (GRCh38)
Location 1:11478667-11478689
Sequence TGGACACTCGCGGGCATCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901762171_901762189 27 Left 901762171 1:11478667-11478689 CCGGGGATGCCCGCGAGTGTCCA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 901762189 1:11478717-11478739 CGGGCTGGCTGGAGAGGAGCGGG 0: 1
1: 0
2: 7
3: 79
4: 700
901762171_901762178 -1 Left 901762171 1:11478667-11478689 CCGGGGATGCCCGCGAGTGTCCA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 901762178 1:11478689-11478711 AGGAGGCTGGTGACCTGCCAAGG 0: 1
1: 1
2: 0
3: 36
4: 303
901762171_901762184 12 Left 901762171 1:11478667-11478689 CCGGGGATGCCCGCGAGTGTCCA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 901762184 1:11478702-11478724 CCTGCCAAGGCTGGGCGGGCTGG 0: 1
1: 0
2: 1
3: 36
4: 408
901762171_901762187 21 Left 901762171 1:11478667-11478689 CCGGGGATGCCCGCGAGTGTCCA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 901762187 1:11478711-11478733 GCTGGGCGGGCTGGCTGGAGAGG 0: 1
1: 0
2: 6
3: 107
4: 976
901762171_901762188 26 Left 901762171 1:11478667-11478689 CCGGGGATGCCCGCGAGTGTCCA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 901762188 1:11478716-11478738 GCGGGCTGGCTGGAGAGGAGCGG 0: 1
1: 0
2: 4
3: 66
4: 813
901762171_901762186 16 Left 901762171 1:11478667-11478689 CCGGGGATGCCCGCGAGTGTCCA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 901762186 1:11478706-11478728 CCAAGGCTGGGCGGGCTGGCTGG 0: 1
1: 0
2: 4
3: 54
4: 450
901762171_901762180 4 Left 901762171 1:11478667-11478689 CCGGGGATGCCCGCGAGTGTCCA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 901762180 1:11478694-11478716 GCTGGTGACCTGCCAAGGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 193
901762171_901762179 3 Left 901762171 1:11478667-11478689 CCGGGGATGCCCGCGAGTGTCCA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 901762179 1:11478693-11478715 GGCTGGTGACCTGCCAAGGCTGG 0: 1
1: 0
2: 3
3: 18
4: 232
901762171_901762181 7 Left 901762171 1:11478667-11478689 CCGGGGATGCCCGCGAGTGTCCA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 901762181 1:11478697-11478719 GGTGACCTGCCAAGGCTGGGCGG 0: 1
1: 0
2: 3
3: 15
4: 188
901762171_901762182 8 Left 901762171 1:11478667-11478689 CCGGGGATGCCCGCGAGTGTCCA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 901762182 1:11478698-11478720 GTGACCTGCCAAGGCTGGGCGGG 0: 1
1: 0
2: 3
3: 19
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901762171 Original CRISPR TGGACACTCGCGGGCATCCC CGG (reversed) Intergenic
900072111 1:779129-779151 GGGACGCTCCCGGGGATCCCCGG - Intergenic
900132256 1:1092132-1092154 TGGTCACGCGAGGGCAACCCAGG + Intronic
900550215 1:3250843-3250865 TGTACCCTCGCAGGCTTCCCAGG - Intronic
901762171 1:11478667-11478689 TGGACACTCGCGGGCATCCCCGG - Intergenic
905934357 1:41811937-41811959 TGGGCACTCGGGGGCTTCTCTGG - Intronic
918177313 1:182057539-182057561 TGGATACTCGGGGGCAAACCAGG - Exonic
922267047 1:223993084-223993106 GGGACGCTCCCGGGGATCCCCGG - Intergenic
922480780 1:225939210-225939232 TGGGCAATCGCTGGCATCCTGGG + Intronic
922870005 1:228894651-228894673 GCGACACTCGCGGACAGCCCTGG - Intergenic
1072608703 10:97002974-97002996 TTGACATCCACGGGCATCCCTGG + Exonic
1083403445 11:62440497-62440519 TGGACACTGGCGTGCACTCCTGG - Intronic
1084120452 11:67066070-67066092 TGGAGACTGGCTGGCCTCCCTGG - Intronic
1092524365 12:9300788-9300810 TGGAAACTCGGGGGCCTCCGGGG + Intergenic
1092542898 12:9431024-9431046 TGGAAACTCGGGGGCCTCCGGGG - Intergenic
1094510116 12:31091413-31091435 TGGAAACTCGGGGGCCTCCGGGG + Intronic
1096466526 12:51849774-51849796 TGGACTCTCTTGGGTATCCCTGG - Intergenic
1097679160 12:62632692-62632714 TGCACACACGCGGGCCTGCCAGG - Intergenic
1102969517 12:117155368-117155390 TGGCCACACGAGGGCATCTCCGG + Intronic
1103948306 12:124539066-124539088 TGGCCGCTCGCGGGCAGCCTGGG - Intronic
1105280792 13:18961511-18961533 TGGACACACTGTGGCATCCCTGG - Intergenic
1109639311 13:65167040-65167062 TGCACACTCGTGTGCATCACTGG + Intergenic
1121977850 14:98422425-98422447 AGCACACTGGCGGGCATCCCAGG - Intergenic
1122388616 14:101365312-101365334 TGGCCACTCGCCGGCAGCCGAGG - Intergenic
1123201256 14:106666569-106666591 TGGAAACACCTGGGCATCCCAGG + Intergenic
1128127969 15:65206889-65206911 TGGACACCTGCGGGCAGCACTGG - Exonic
1130734620 15:86535350-86535372 AGGACAGTCGGGGACATCCCTGG + Intronic
1132779393 16:1614415-1614437 GGGACCCTCCCGGGCCTCCCCGG - Intronic
1133238902 16:4403221-4403243 TGCACACTCATGGGCATCACTGG + Intronic
1133540845 16:6751905-6751927 TGGACTCACGCTGGCACCCCTGG - Intronic
1140887705 16:79259241-79259263 TGGGCAAGCGTGGGCATCCCAGG - Intergenic
1141786768 16:86206040-86206062 TGAACCCTAGCGGGCTTCCCAGG - Intergenic
1144038302 17:11386864-11386886 TGGACAGTCCTGGGCAACCCGGG - Intronic
1145831386 17:27919349-27919371 TGGACACAAGGGGGCATCCCTGG - Intergenic
1151201493 17:72471018-72471040 TGGAAACTGGGGGGAATCCCTGG - Intergenic
1152217909 17:79045160-79045182 AGGACACCTGCGGGCCTCCCAGG + Intronic
1152737223 17:82003502-82003524 TGGCCACTCGCTGGCAGGCCCGG + Intronic
1156395626 18:36697245-36697267 TGGTCCCTGGAGGGCATCCCGGG + Intronic
1168266468 19:55226419-55226441 TGGAGGCTCCCGGGAATCCCTGG - Intergenic
925148603 2:1599760-1599782 TGGGCCCTCCAGGGCATCCCAGG - Intergenic
925996605 2:9298611-9298633 TGGACACTGGCAGGCATGCATGG + Intronic
929539724 2:42810364-42810386 GCGACACTCGCAGGCTTCCCCGG + Intergenic
931201014 2:60097308-60097330 TGGCCACCCATGGGCATCCCTGG - Intergenic
937318423 2:120946759-120946781 TGGACACTTGCCCCCATCCCAGG - Intronic
937486377 2:122319017-122319039 TGGACTGTCCCAGGCATCCCAGG - Intergenic
941169441 2:162118930-162118952 TGAACATTCACGTGCATCCCAGG - Intergenic
942454564 2:176129399-176129421 TGGACACGCGGGTGCAGCCCAGG - Intergenic
948454497 2:238098478-238098500 TGCACACTCGCTGGCACTCCAGG - Exonic
1183020498 22:35022605-35022627 AGGACATTGGCCGGCATCCCTGG + Intergenic
1183075725 22:35425719-35425741 TGGGGACTCGCGTGCATCTCAGG + Intergenic
1183281698 22:36935852-36935874 TGGGCACTCCAGGGAATCCCGGG - Intronic
1184876188 22:47277193-47277215 TGCACACAGGCGGGCTTCCCCGG + Intergenic
952847967 3:37704316-37704338 TGGAGACACGCGGGCACCTCAGG - Intronic
969669877 4:8583730-8583752 TGGGCACTCTGGGGCCTCCCGGG - Intronic
969934426 4:10666856-10666878 TGGACACCTGTGGGCATCCATGG + Intronic
972712574 4:41612370-41612392 GGGACTTTCGCGAGCATCCCAGG + Intronic
981606671 4:146547220-146547242 TGGAAGCTGGCTGGCATCCCAGG + Intergenic
997934939 5:138102254-138102276 TGGACACTTGTGGGCATCGATGG - Intergenic
1002347110 5:178555787-178555809 TAGTGACTCGGGGGCATCCCAGG - Intronic
1002873725 6:1191202-1191224 TGGACACTGGCAGGCATGGCCGG - Intergenic
1026615293 7:71897080-71897102 TGGAAACTTGCAGGCAGCCCTGG + Intronic
1038838715 8:31158854-31158876 TGGCCACTCCCCCGCATCCCTGG - Intronic
1043221673 8:77673567-77673589 TGGACTCTCCAGGGCTTCCCAGG + Intergenic
1049287066 8:141781612-141781634 TGGAAACTCTGGGCCATCCCTGG - Intergenic
1053270359 9:36745388-36745410 TGGTGACTCCTGGGCATCCCAGG + Intergenic
1062637332 9:137498481-137498503 GGGGCACTCGCGGGCCTGCCAGG - Intronic
1199765156 X:150935990-150936012 TTGTCACTCCTGGGCATCCCGGG + Intergenic
1200486721 Y:3778093-3778115 TGGACCCTTGAGGGCTTCCCAGG + Intergenic