ID: 901762661

View in Genome Browser
Species Human (GRCh38)
Location 1:11480662-11480684
Sequence GTGTGTGCACGCGCGCGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 3, 2: 4, 3: 68, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901762661_901762664 23 Left 901762661 1:11480662-11480684 CCCCAGCGCGCGCGTGCACACAC 0: 1
1: 3
2: 4
3: 68
4: 192
Right 901762664 1:11480708-11480730 CACACACTGTCCTGCTCCTATGG 0: 1
1: 0
2: 2
3: 29
4: 180
901762661_901762665 24 Left 901762661 1:11480662-11480684 CCCCAGCGCGCGCGTGCACACAC 0: 1
1: 3
2: 4
3: 68
4: 192
Right 901762665 1:11480709-11480731 ACACACTGTCCTGCTCCTATGGG 0: 1
1: 0
2: 0
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901762661 Original CRISPR GTGTGTGCACGCGCGCGCTG GGG (reversed) Intronic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
901361388 1:8703506-8703528 GTGTGTGCGCGCGCCCGCGGCGG - Intronic
901443876 1:9295236-9295258 GTGTGTGCGCGCGTGCGGTTGGG + Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
903353571 1:22732528-22732550 CTGTGTGCACACGCGCACTGAGG - Intronic
904399080 1:30243946-30243968 GTGGGTGCACACGGGAGCTGAGG + Intergenic
906791937 1:48666513-48666535 GTGTGTGCACGTGCATGCTAAGG - Intronic
907387867 1:54137699-54137721 GTGTGTGCATGCGGGGGCAGGGG + Intronic
907526476 1:55056863-55056885 GTGCGTGCGCGCGCGCGCGTTGG + Intronic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
907656797 1:56351552-56351574 GTGTGTGTGCTCGTGCGCTGGGG + Intergenic
908252903 1:62279183-62279205 GTGTGTGCGCGCGCTAGCTTAGG - Intronic
912453910 1:109785287-109785309 GTGTGTGAGTGTGCGCGCTGAGG + Intergenic
912717568 1:111992585-111992607 GTGTGAGCACCCGCGAGCTCAGG + Intergenic
913319408 1:117577907-117577929 GTGTGCGCGCGCGCGCAATGAGG + Intergenic
913549839 1:119906758-119906780 GTGTGTGCAGGTGCTAGCTGTGG + Intergenic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920524997 1:206659793-206659815 GTGTGTGCGCGCGCACGCACCGG - Intronic
921708023 1:218346039-218346061 GTGTGCGTGTGCGCGCGCTGGGG - Intergenic
922817256 1:228458676-228458698 GTGTGTGTGCGCGCGCGCGCCGG + Exonic
924799340 1:247316229-247316251 GTGTGTGTGAGCGCGCGCAGTGG + Intronic
924799342 1:247316231-247316253 GTGTGTGAGCGCGCGCAGTGGGG + Intronic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1064306826 10:14174913-14174935 GTGTGTGGACGCGCGCGTACGGG + Intronic
1067222771 10:44355974-44355996 GTGTGTGCACGCTAGGGGTGGGG + Intergenic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1071526874 10:86364294-86364316 CTGTGTGCACGTGTGCGCTGAGG - Intronic
1072881252 10:99232194-99232216 GTATGCGCGCGCGCGCGTTGGGG - Intronic
1072881254 10:99232196-99232218 GTGTATGCGCGCGCGCGCGTTGG - Intronic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1074516936 10:114179254-114179276 GAGTGCGCAGGCGTGCGCTGAGG + Exonic
1076670959 10:132120921-132120943 GTGTGTGGCCGCTCGAGCTGCGG + Intronic
1078823500 11:14905777-14905799 GTGTGTTCGGGCGCGCGTTGGGG + Intronic
1079798163 11:24833699-24833721 GTGTGTGTGCGCGCGCGCGGTGG - Intronic
1082923204 11:58518288-58518310 GTGTGACCACGCACGAGCTGGGG - Intergenic
1083753616 11:64777796-64777818 GAGTGCGCACGCGCGCTGTGGGG - Intronic
1084285103 11:68125903-68125925 GTGTGTGCGCGCGCGCGTTATGG - Intergenic
1086852833 11:91831118-91831140 GTGTGTGCACGTGCCCCCTTTGG + Intergenic
1088907053 11:114162848-114162870 GTGTGTTCAAGAGCGAGCTGGGG - Intronic
1089777599 11:120849152-120849174 GTGTGTGTGTGCGCGCGTTGGGG - Intronic
1091023852 11:132124617-132124639 GTGTGTGCGCGCGCACGCGCAGG + Intronic
1091276960 11:134359190-134359212 GGCTGTGCACGCTCCCGCTGTGG + Intronic
1092255326 12:6923972-6923994 GTGTGTGCACGCGCATTTTGGGG + Intergenic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1097195520 12:57240558-57240580 GTGTGTGTGTGCGCGCGCCGGGG - Intronic
1097232434 12:57520834-57520856 GTGTCTGCACGCGCACGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1101966403 12:109285265-109285287 GTGTGTGTGTGCGCGCACTGCGG + Intronic
1102645518 12:114401071-114401093 GCATGTGCACGCGCGCGCCCAGG - Intronic
1105438119 13:20394631-20394653 GTGTGTGTCCGCGCGCGCTCAGG - Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1107045047 13:35984882-35984904 GTGTGTGCATGCGCACGCTGGGG - Intronic
1107459236 13:40585330-40585352 GTGTGTGTGCGCGCGCGCAGAGG - Intronic
1107996750 13:45868659-45868681 GTATGTGCATGCGCGCGCACGGG + Intergenic
1108530891 13:51326038-51326060 GTGTGTGCGCGCGCGCACGTGGG + Intergenic
1111343437 13:86917682-86917704 GTGTGTGCGCGCGCACGTGGTGG - Intergenic
1112508764 13:99990827-99990849 GTGTGTGTGCGCGCGCGCAAAGG - Intergenic
1113286526 13:108855204-108855226 GTGTGTGCACCTGCACACTGGGG + Intronic
1114492258 14:23110564-23110586 GTGGGTTCAAGCGCGTGCTGAGG - Intergenic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1115054343 14:29104509-29104531 GTGTGTGCACACACACACTGTGG + Intergenic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1120497411 14:85254069-85254091 GTGTGTGTGTGCGCGCGTTGTGG - Intergenic
1123007874 14:105333146-105333168 GTGTGTGCACACGCGTGCATGGG - Intronic
1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG + Intronic
1123054746 14:105563989-105564011 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123079186 14:105683548-105683570 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1126348119 15:47717785-47717807 GTGTGTGTGTGCGCGCGGTGGGG + Intronic
1128582788 15:68820623-68820645 GTGTGTGTGTGTGCGCGCTGGGG - Intronic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129687151 15:77693061-77693083 GTGTGTGCACGCGTGCACATGGG - Intronic
1129741243 15:77990656-77990678 GTGTGTGCGCGCGCATGTTGGGG - Intronic
1130154129 15:81334884-81334906 GGGTGTGCCCGAGTGCGCTGAGG + Exonic
1132460905 16:54059-54081 GTGTGTGCGGGCGGGGGCTGGGG + Intronic
1132485360 16:187514-187536 GTGGGCGCACACGGGCGCTGTGG - Intergenic
1132522305 16:397381-397403 GTGCGCGCACGTGCGGGCTGGGG + Intronic
1133924261 16:10181172-10181194 GTGTGTGCACGCGCGCGTGTAGG - Intronic
1135037738 16:19092171-19092193 GTGTGTGTGCGCGCGCGCATTGG + Intergenic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1137604337 16:49777008-49777030 GTGTGTGCACATGCGCACTATGG + Intronic
1139429422 16:66903262-66903284 GTGTGTGCACGTGAGCACTTGGG - Intergenic
1141582830 16:85011809-85011831 GTGTGTACCCGCGCCCGCGGCGG + Intergenic
1143102603 17:4512638-4512660 GTGTGTGCGTGCGCGCGCACGGG + Intronic
1144172835 17:12676230-12676252 GTGTGTGCGTGCGCGCGCAGGGG - Intronic
1144624140 17:16836160-16836182 GTGTGTGCACGCACACACGGTGG - Intergenic
1144684385 17:17216357-17216379 GTGCGTGCCCCCGCGGGCTGTGG - Intronic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1144801159 17:17928576-17928598 GTGTGTGCATGCTCACGCGGGGG - Intronic
1144882286 17:18436559-18436581 GTGTGTGCACGCACACACGGTGG + Intergenic
1145149948 17:20507827-20507849 GTGTGTGCACGCACACACGGTGG - Intergenic
1146972048 17:37081338-37081360 GTGTATGCACGCGCGCGTGGGGG + Intergenic
1147139487 17:38453453-38453475 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1147726042 17:42566780-42566802 GTGTGTGCACGCGCACTGTCCGG - Intergenic
1147864956 17:43545977-43545999 GTGTACGCGCGCGCGCGCGGAGG + Intronic
1148563406 17:48619262-48619284 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152549128 17:81020679-81020701 GTGTGTGCTCGCGGGCACTCAGG + Intergenic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG + Intronic
1153688630 18:7568728-7568750 GTGCCTGCACGCGCGCGCGGGGG + Intronic
1153923166 18:9809050-9809072 GTGTGTGCGCGCGCACGCGTGGG + Intronic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1156000353 18:32378052-32378074 GTGTGTGCGCGCGGGCGCTTTGG + Intronic
1156099776 18:33578854-33578876 GTGTGTGCGTGCGCGCGCGGAGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1158400924 18:57121187-57121209 GTGTGTGCACGCGAGTGCGCAGG + Intergenic
1160795032 19:941248-941270 GAGTGTGCACGCTGGGGCTGTGG + Intronic
1161264778 19:3359276-3359298 GTGTGTGTGCGCGCGCGCCGCGG + Intergenic
1166126019 19:40715863-40715885 GTGTGTGTGCGCGCGCGCGTTGG + Intronic
1166302186 19:41917608-41917630 GTGTGTGCATGCGGGGGCGGCGG - Intronic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926435795 2:12836256-12836278 GTGTGTGCGCACACGCGCTGAGG + Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927235518 2:20870908-20870930 GTGTGTGCGCGCGCGCATTCAGG + Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
928757884 2:34547535-34547557 GTGTGTGCAGGTGCTGGCTGTGG + Intergenic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
929667815 2:43846975-43846997 GTGTGTGCACGCGCGCGTGCAGG - Intronic
932588816 2:73050381-73050403 GTGTGTGTGTGCGTGCGCTGTGG - Intronic
933817235 2:86077796-86077818 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
937080102 2:119134706-119134728 CTGTGTGCACGAGCCCGTTGTGG + Intergenic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
941580808 2:167293576-167293598 GTGTGTGCGCGCGCGCGGCTTGG + Intergenic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
945033359 2:205684939-205684961 GTGTGTGCGCGCTCGCGCGCTGG - Intronic
946852487 2:223920610-223920632 GTGTGTGAACACGCCGGCTGTGG + Intronic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
948874609 2:240820028-240820050 GTGGGTGCAGGTGCGGGCTGCGG + Intronic
1169118620 20:3082816-3082838 GTGTGAGCACGGGCGCCCTGGGG + Intronic
1169832240 20:9838174-9838196 GTGTGTGCGCGCGCGCCTGGTGG - Intronic
1170960255 20:21019491-21019513 GTGTGTGCGCGCGCGCGGCAGGG - Intergenic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1172118302 20:32584122-32584144 GTGTGTGTGTGCGCGCGCGGAGG - Intronic
1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG + Exonic
1173429589 20:42974458-42974480 GTGTGTGCGCGCGTGCACTGAGG - Intronic
1174887018 20:54347078-54347100 GTGTGTGCATGTGCGTGCTTTGG + Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1176112998 20:63418984-63419006 GTGTGTGCAGGCCTGCGCTGGGG - Intronic
1179569250 21:42268381-42268403 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1180997212 22:19971505-19971527 GTGTGTGCACGTGCCCGCCCTGG - Intronic
1181069257 22:20322341-20322363 GTGTGTGCGCGCGCGCACAATGG - Intergenic
1182041635 22:27242811-27242833 GTGTGTGCGCGCGTGCGCGGGGG - Intergenic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1183264462 22:36816833-36816855 GTGTGGGCAGAAGCGCGCTGGGG + Intronic
949255000 3:2035543-2035565 GTGTGTGCACACATGTGCTGAGG - Intergenic
952316865 3:32238982-32239004 GTGTGCGAGCGGGCGCGCTGCGG - Exonic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
954679962 3:52339824-52339846 GTGTGTGTACACACGTGCTGGGG + Intronic
955534378 3:59907605-59907627 GTGTGTGCATGTGTGCACTGGGG + Intronic
955663260 3:61323981-61324003 GTGTGTGTGTGCGCGCGTTGGGG + Intergenic
956897257 3:73675471-73675493 GTGTGTGCACCCACGCGTGGTGG + Intergenic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
960047441 3:113211695-113211717 GTGTCTGTGCGCGCGCGCGGCGG - Exonic
961002560 3:123383815-123383837 GTGTGTGCACGTGCACCTTGAGG - Intronic
963448725 3:145449208-145449230 GTGTGTGCACGCGTGCACCATGG + Intergenic
966161277 3:176971299-176971321 GTGTGTGCATGCACGTGCTTCGG + Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
967118498 3:186362332-186362354 GTGTGTGTACGCGCGCGCGCCGG - Intergenic
967858504 3:194135024-194135046 GTGTGTGTGCGCGCGCCCCGGGG - Intergenic
968495697 4:914261-914283 GTGTGTGGCCGTGCACGCTGGGG - Intronic
968495756 4:914519-914541 GTGTGTGGCCGTGCACGCTGGGG - Intronic
968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG + Intergenic
969533819 4:7743791-7743813 GTGTGTGCGCGCGCGCGTGAGGG - Intergenic
970826545 4:20283105-20283127 GTGTGTGCGCGCGCGCACACAGG - Intronic
971809569 4:31406810-31406832 GTGTGTGTCCGCGCGCGTTGGGG - Intergenic
975485860 4:74933580-74933602 GTTTGTGCGGGCGCGGGCTGCGG - Intronic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
978384967 4:108169151-108169173 GTGTGTGCGCGCGCGCCTGGAGG + Intergenic
983672166 4:170250617-170250639 GTGTGTGCGCGTGCGAGCTGTGG + Intergenic
987901085 5:24013042-24013064 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
995022822 5:107385070-107385092 GTGTGTGCATACGTGTGCTGGGG - Intronic
995250157 5:109983944-109983966 GTGTGTGCGCACGCGCACAGTGG - Intergenic
997459874 5:134044655-134044677 GTGTGTGTGCGCGCGCGCACAGG + Intergenic
998143248 5:139711409-139711431 GTGTGTGCGCGCGCGCTCCGAGG + Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001293504 5:170483113-170483135 GTGTGTGCACCTGCAGGCTGTGG + Intronic
1002058834 5:176614168-176614190 GTGTGTGTGCGCGCGCGCAGGGG - Intergenic
1002559739 5:180072914-180072936 GTGTGCGCGCGCGCGCGTTTCGG - Intergenic
1003030766 6:2598748-2598770 GTGTGTGTGTGCGCGCGCTGGGG + Intergenic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1005942621 6:30571924-30571946 GTGTGTGTATGCGCGCGCAGGGG - Intronic
1006137242 6:31902397-31902419 ACGGGTGCGCGCGCGCGCTGCGG - Intronic
1012515945 6:100059382-100059404 GTGCGTGCGCGCACGCACTGAGG + Intergenic
1012606904 6:101168615-101168637 GTGTGTGCACGCATGCTGTGTGG + Intergenic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1014109283 6:117602370-117602392 GAGTGTGCCCGCGCGCGCGGGGG - Intronic
1014632353 6:123803243-123803265 GTGTGTGCGCGCGCGCTCGGGGG - Intergenic
1014632355 6:123803245-123803267 GTGTGTGTGCGCGCGCGCTCGGG - Intergenic
1017164516 6:151394778-151394800 GTGTGTGTGTGCGCGCGCTTAGG + Intergenic
1017175081 6:151494720-151494742 GTGTGTGTGCGCGCGCGCATTGG - Intronic
1017973983 6:159338224-159338246 GTGTGTGCAGGCACCTGCTGTGG - Intergenic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1019711353 7:2519574-2519596 GGGCGTGCACGTGCGCGCCGGGG + Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021107627 7:16656542-16656564 GTGTGTGTGCGCGCGCGCGCTGG - Intronic
1023319419 7:38976616-38976638 GTGTGTGTGCGCGCGCGCTTCGG + Intergenic
1026665604 7:72337393-72337415 GTGTGAGTGCGCGCGCGCCGAGG - Intronic
1028399760 7:90412446-90412468 GTGTGTGCACCTGTGCTCTGAGG + Intronic
1029449595 7:100633393-100633415 GTGAGTGCGCGCGCGGGCGGGGG - Intronic
1031088438 7:117324736-117324758 GTGTGTGCACGCCGGCCATGGGG + Intergenic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032013413 7:128360972-128360994 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
1038644714 8:29351930-29351952 GTTTGTGCACGCACGCGGTGGGG + Intergenic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1039846237 8:41327428-41327450 GTGTGTGCACATGCACGCTTGGG - Intergenic
1045287780 8:100806878-100806900 GTGTGTGCGCGCGCACGCACAGG + Intergenic
1046209406 8:111048004-111048026 GTGTGTGTGCGTGCGCACTGGGG + Intergenic
1047423565 8:124727079-124727101 GTGTGCGCGCGCGCGCGTGGGGG - Intronic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1048244050 8:132774815-132774837 ATGTGTGTACGCGCGTGCTCAGG - Intergenic
1048454819 8:134568046-134568068 GTGTGTGCACTCATGTGCTGGGG - Intronic
1048484255 8:134832340-134832362 GTGTGTGTGCGCGCGCGCGTGGG + Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050091283 9:2017556-2017578 GTGTGTGCGCGCGCGAGCGGCGG + Intronic
1050771851 9:9211500-9211522 GTGTGTGCGTGCGCACACTGGGG - Intronic
1057401616 9:94728224-94728246 GTGTGTGCATGCGCGCACGCAGG - Intronic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1060463867 9:123884982-123885004 GTGTGTGCGCGCGCGCTCGCAGG - Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1061006095 9:127929196-127929218 GTGTGTGCATGTGTGCGCAGTGG - Intronic
1062104286 9:134744914-134744936 GTGTGTGCACGTGCACGCCTGGG - Intronic
1062320521 9:135988573-135988595 CTGTGTGCACAGGCGCGTTGGGG + Intergenic
1185723143 X:2397919-2397941 GTGTGTGTGTGCGCGCTCTGAGG - Intronic
1186209982 X:7240450-7240472 GTGTGTGCGCGCGCGCTCCTTGG - Intronic
1186490594 X:9969422-9969444 GTGTGTGCGCGCGTGCACTGGGG - Intergenic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1188597812 X:31922522-31922544 GTGTGCGCGCGCGTGCGCTAGGG + Intronic
1194035534 X:88866236-88866258 GTGTGTGTGCGCGCGCGCAAAGG + Intergenic
1194035536 X:88866238-88866260 GTGTGTGCGCGCGCGCAAAGGGG + Intergenic
1197559848 X:128006303-128006325 GTGTGTGCACGCGCACGCGTGGG - Intergenic
1197655139 X:129108644-129108666 GTGTGTGTGCGCGCGCGCGGCGG + Intergenic
1197655141 X:129108646-129108668 GTGTGTGCGCGCGCGCGGCGGGG + Intergenic
1198115493 X:133540946-133540968 GTGTGTGTGTGCGCGCACTGTGG + Intronic
1198441506 X:136667841-136667863 GTGCGTGCACGTGCGCGCTTGGG - Exonic