ID: 901766389

View in Genome Browser
Species Human (GRCh38)
Location 1:11502517-11502539
Sequence CAGGGTCAGAGAGAGGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 366}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901766389 Original CRISPR CAGGGTCAGAGAGAGGTTGT GGG Intronic
900225820 1:1533251-1533273 CAGGGTCAGGGTCAGGGTGTGGG - Intronic
900552805 1:3265046-3265068 CTGGGTCAGAGAGAGGCTGGGGG - Intronic
900685608 1:3945913-3945935 CAGGGACAGAGAGAGGGGGGTGG - Intergenic
901766389 1:11502517-11502539 CAGGGTCAGAGAGAGGTTGTGGG + Intronic
902293593 1:15451071-15451093 CAGGGTCAGAGAGAGATTTAAGG + Intergenic
903159165 1:21472567-21472589 AAAGTTCAGAGAGAGGCTGTAGG + Intronic
903333373 1:22608908-22608930 GAGGGTCATACAGAGGTTCTTGG - Intergenic
903668981 1:25024479-25024501 CAGGGCCAGAGAGAGGTTCTGGG + Intergenic
905022256 1:34825870-34825892 CAGGTTCAGAGTCAGGTTGGGGG + Intronic
905336934 1:37251189-37251211 CAGAGTCTGAGAGAGGGTGTGGG - Intergenic
905522509 1:38611358-38611380 CAGCATCGGAGAGATGTTGTGGG - Intergenic
907183781 1:52593125-52593147 CAGGTGCAGAGATAGCTTGTGGG + Intergenic
907332607 1:53681060-53681082 CAGGGTCAGAGAGAGGATGCAGG + Intronic
910446453 1:87303172-87303194 CAGGCTCAGTGGCAGGTTGTGGG - Intergenic
910769636 1:90818023-90818045 CAGAGAGAGAGAGAGATTGTGGG + Intergenic
911724523 1:101228578-101228600 CAGGGCTAGAGAGAAGTGGTTGG - Intergenic
915813924 1:158947288-158947310 CAGGTGTAGAGAGAGATTGTGGG + Intronic
915822020 1:159034407-159034429 CAGGTGTAGAGAGAGATTGTGGG + Intronic
917223977 1:172762221-172762243 ATGAGGCAGAGAGAGGTTGTGGG + Intergenic
917440818 1:175067293-175067315 GAGGGTCAGAGTGGGCTTGTGGG + Intergenic
919275635 1:195412502-195412524 CATGGTCATAGTGAGTTTGTGGG - Intergenic
919341923 1:196321229-196321251 CAGGGTGAGAGAGATGTGGAGGG - Intronic
920937092 1:210445696-210445718 CAGTGTTTGAGAGAGGTGGTTGG + Intronic
921052470 1:211520749-211520771 CAGAGTGAGAGAGAGTGTGTCGG + Intergenic
922174735 1:223188696-223188718 TAGGGGCAGAGAGAGGATGAAGG + Intergenic
922471555 1:225880235-225880257 AAAGGTCTGAGAGAGATTGTGGG - Intronic
922964178 1:229674273-229674295 CAGGGGGAGAGGGAGGCTGTGGG - Intergenic
923256319 1:232224459-232224481 CAGGGTCATCCAGAGGTGGTGGG - Intergenic
924047965 1:240051921-240051943 CAGGGTCTGGGAGAGGTTGTGGG - Intronic
924306127 1:242690911-242690933 CAGTGTCAGAGACATGTAGTGGG - Intergenic
924424428 1:243938272-243938294 TAGGGGCAAAGAGAGGTTTTTGG - Intergenic
1063460873 10:6214359-6214381 CACGGACAGGGAGGGGTTGTGGG - Intronic
1065125328 10:22568456-22568478 TGGGGTCAGAGAGTGGCTGTGGG - Intronic
1067533035 10:47088289-47088311 CATGGGCAGAGAGAGGAGGTGGG + Intergenic
1068855873 10:61796710-61796732 CAGAGTAAGGGAGAGGTTATAGG - Intergenic
1068897993 10:62228897-62228919 GAGGGGCAGAGAGAGGATATTGG + Intronic
1069774422 10:70918494-70918516 CTGGGTGACAGAGAGGCTGTAGG + Intergenic
1070284969 10:75076254-75076276 CAAGCTCAGAATGAGGTTGTAGG - Intergenic
1070396289 10:76013659-76013681 CAGGGACAGAGGGAGGTGGGGGG + Intronic
1070606210 10:77900273-77900295 CTGGGTCAGGGAGGGGTTGCAGG - Intronic
1071290347 10:84184611-84184633 CGAGGTCAGAGCCAGGTTGTGGG - Intronic
1071712740 10:88065572-88065594 CAGGGACAGTGAGGAGTTGTTGG + Intergenic
1072195975 10:93117751-93117773 CAGGGTTAGAAAGAGGTGATGGG - Intergenic
1073835059 10:107431718-107431740 CAGAGTCAGAGAGAGGAGTTCGG - Intergenic
1073949034 10:108785409-108785431 CTGGGTCAGAGTGAGGGTGGGGG - Intergenic
1074354245 10:112768059-112768081 CAGGGACAGAGAGGGGTTGAGGG - Intronic
1074894689 10:117765098-117765120 CAGGGTCACAGAGATGTTCCTGG - Intergenic
1075433812 10:122416313-122416335 CAGGGAAAGAGAGCTGTTGTGGG + Intronic
1075584811 10:123649956-123649978 CAGGGGCAGAGAGTGGCTGTTGG + Intergenic
1076158388 10:128221820-128221842 CACGGTCAGAGGGAGGTTCAGGG - Intergenic
1076223924 10:128758243-128758265 CGGGGAGAGAGAGAGGTTGGGGG - Intergenic
1076963699 10:133787274-133787296 CAGGGTCAGGGTGAGGGTGAGGG + Intergenic
1077253338 11:1570361-1570383 CACAGTGAGAGAGAGGTGGTTGG - Intronic
1077405127 11:2379288-2379310 CAGGGGCCGAGGGAGGGTGTAGG + Intronic
1077554114 11:3217821-3217843 CAGGGTAAGAGCTAGGTGGTGGG + Intergenic
1077577934 11:3398503-3398525 CAAGGTCACAGCGAGGTGGTTGG + Intergenic
1077783932 11:5362118-5362140 CAAAGTCAGAGAGAGCTTGTTGG + Intronic
1077916551 11:6615394-6615416 CAGGGTAAGAGTGAGGATGGGGG - Intronic
1078763558 11:14272117-14272139 GGTGGTCAGATAGAGGTTGTTGG - Intergenic
1081336662 11:41875060-41875082 CAGGGAGACAAAGAGGTTGTTGG + Intergenic
1081456515 11:43228640-43228662 CAGGGTCAGAGAGTGGGGGAGGG - Intergenic
1082082011 11:48019378-48019400 CAGGCTCAGAGAAAGGAGGTGGG - Intronic
1082194970 11:49292962-49292984 CAGGGTGAGACAGATATTGTGGG + Intergenic
1082877452 11:58002641-58002663 TAGAGTCAGAGAGAAGTGGTAGG + Intergenic
1084401418 11:68946023-68946045 CTGAGTCAGAGACGGGTTGTGGG - Intergenic
1084664900 11:70571097-70571119 CAGGGTCAGAGAGGCCTTGGGGG - Intronic
1084805431 11:71575690-71575712 CAGGATCAGAGACAGGGTTTGGG - Intergenic
1085269812 11:75263579-75263601 CATGGTCAGGGAAACGTTGTAGG - Intergenic
1085739079 11:79063808-79063830 CAAGGCCTGAGAGAGGCTGTGGG - Intronic
1086660960 11:89416592-89416614 CAGGGTTAGACAGATATTGTGGG - Intronic
1088889462 11:114033214-114033236 CAGGGTCAGAATCAGGATGTGGG - Intergenic
1089196520 11:116696708-116696730 CAAGGTCAGAGAGAAGGGGTGGG + Intergenic
1089528240 11:119110646-119110668 CAGTGTCAGAGTGACGTGGTAGG - Exonic
1089765354 11:120759222-120759244 CAGGGTCAGAGAGAAGCTTTTGG + Intronic
1090206088 11:124885183-124885205 CAGGGGCAGGGAGAGGTTGGGGG + Exonic
1090212709 11:124934042-124934064 CAGGGTTGGAGAGAGGTATTTGG - Intronic
1090278349 11:125435311-125435333 CATGCACAGAGAGAGGTTGTTGG - Intergenic
1090552712 11:127840673-127840695 CTGGGTGAGAGAGAGGATCTGGG + Intergenic
1091257828 11:134206310-134206332 CAGCCTCAGAGAGAGGATGGTGG - Intronic
1091695261 12:2624031-2624053 CAGGGCCAGTGAGAGGTGCTGGG + Intronic
1091854729 12:3730312-3730334 GAGGGTCAGCAAGAGGTGGTGGG + Intronic
1092262743 12:6961222-6961244 CAGGGTCAGGGAGAGGTGGGGGG - Exonic
1092350012 12:7748666-7748688 CAGGGGCAGAGGGAGGTTCAGGG - Intronic
1092564359 12:9648608-9648630 TTGGATCAGAGAGAGGTTGGGGG - Intergenic
1092763296 12:11829012-11829034 CTGGATCAGGGAGAGGTTGGAGG - Intronic
1092777130 12:11953526-11953548 CAGGGTCACAGAGAGGACCTGGG - Intergenic
1093999659 12:25681201-25681223 CAGAGGCAGAGATAGGATGTGGG + Intergenic
1094507334 12:31073151-31073173 CAGGGTCAGGGAGAGTTGCTGGG - Intergenic
1096477125 12:51915140-51915162 CAGGGTCAGGGTGGGGTTGGGGG - Intronic
1096551085 12:52372028-52372050 AAGGGTCAGAGAGATGGTATAGG - Intergenic
1096595393 12:52691900-52691922 CAGGGGCAGAGAGAGGCTGGTGG - Intronic
1096749361 12:53748855-53748877 AAGGGTCAGGTAGAGGTTGCAGG + Intergenic
1097264623 12:57738184-57738206 CAGGGTCAGCGAGATGAGGTAGG + Exonic
1098663288 12:73127145-73127167 AAGGATCAGAAAGAGGTTGTGGG + Intergenic
1102580448 12:113883072-113883094 GACAGACAGAGAGAGGTTGTAGG + Intronic
1102759164 12:115370371-115370393 GAGGATCAGAGAGAGTGTGTGGG + Intergenic
1102830246 12:115991615-115991637 CAGGGTAACATAGAGGCTGTGGG + Exonic
1107619733 13:42213979-42214001 GAGGCTCAGAGAGACGTGGTAGG - Intronic
1108698900 13:52926973-52926995 CAGAGTTAGAGAGAGGTTTGGGG + Intergenic
1112104059 13:96221217-96221239 TAGGGTCAGAGAGAGTTTTTGGG + Intronic
1113462349 13:110491057-110491079 CAGGCTCAGAGGGAGGAAGTAGG + Intronic
1114387755 14:22272631-22272653 CAGGGTGAGAGGGAAGTGGTAGG + Intergenic
1115294822 14:31813688-31813710 CAGGGTCTGTCAGAGGTTGGGGG - Intronic
1115334504 14:32231373-32231395 CAGGTTTAGAGAAAGGGTGTCGG + Intergenic
1115701236 14:35955065-35955087 CAGGGTCAGATAGACGATGTGGG + Intergenic
1115892707 14:38049690-38049712 CAGGCTCAGAGGGAAGTGGTGGG + Intergenic
1119364737 14:74082244-74082266 AAGGAGCAGAGAGAGGTTTTAGG + Intronic
1119904519 14:78289494-78289516 AAGAGTCAGAATGAGGTTGTAGG - Intronic
1120787108 14:88548128-88548150 TAGGGTTGGAGAGAGGTGGTTGG - Intronic
1121063809 14:90941589-90941611 CAGGGGCAGAGATAGGATCTGGG + Intronic
1121467866 14:94127671-94127693 GAGGGGCAGAGGGAGGTGGTTGG - Intergenic
1122544860 14:102516813-102516835 CATGGTCGGAGAGAGTTTGCAGG + Intergenic
1122830902 14:104395224-104395246 CAGGGTCAGGGAGAGGGTAGGGG + Intergenic
1202852409 14_GL000225v1_random:30011-30033 CAAGGGCAGAGAGAGGCTGGAGG - Intergenic
1124214948 15:27798562-27798584 CAGGGTCAGAGCGAGGAAGCAGG - Intronic
1124551307 15:30683475-30683497 CAGGGACTGGGAGAGGGTGTAGG - Intronic
1124679940 15:31722190-31722212 CAGGGACTGGGAGAGGGTGTAGG + Intronic
1124956667 15:34364822-34364844 CTGGGACAGAGAGAAGGTGTTGG - Intronic
1125144452 15:36450713-36450735 AAGGGTGAGAAAGAGGATGTAGG - Intergenic
1125665821 15:41429314-41429336 CAGGGACAGAGAGAAGTGGAAGG - Intronic
1125818718 15:42609284-42609306 CAGGGTTAGAGAGAGGACTTGGG - Intronic
1125957287 15:43799291-43799313 CAGGGTAAGTGAGAGGGGGTCGG - Exonic
1127550190 15:60029928-60029950 TAAGGTCAGAGAGAGGGTGGTGG - Intronic
1127779880 15:62302863-62302885 CAGGGGCAAAGAGAGGCTTTGGG - Intergenic
1128796428 15:70469893-70469915 CAGGGTCAGAGAGATGGCCTGGG + Intergenic
1128833225 15:70788217-70788239 CAGAGTGAAAGAGAGGTTATGGG - Intergenic
1130622895 15:85482504-85482526 CAATGTCAGGGAGAGTTTGTAGG + Intronic
1130810872 15:87377349-87377371 GAGTGTCAGAGAGTGGGTGTAGG + Intergenic
1131333459 15:91524353-91524375 CGGGCACAGAGAGAGGTTGGGGG + Intergenic
1132542019 16:514665-514687 CAGGGCCCGGGAGAGGTTCTAGG + Intronic
1134053305 16:11152786-11152808 CAGTGTCAGAGGGAGGCTGGAGG - Intronic
1134674122 16:16077479-16077501 AAGGGTTAGAGAAAGGTTCTGGG - Intronic
1138543881 16:57705162-57705184 CAGGGCCAGGTAGAGGTTGGGGG - Intronic
1139545697 16:67648588-67648610 CAGGATCTGGGGGAGGTTGTGGG - Intronic
1139775360 16:69313399-69313421 CTGGGAGAGAGAGGGGTTGTGGG - Intronic
1140190106 16:72808309-72808331 CAGGGTTAGAGGGAATTTGTGGG - Intronic
1142378029 16:89716963-89716985 CAGGGTCAGTGAGGGGATGGGGG - Intronic
1142600713 17:1052350-1052372 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600730 17:1052394-1052416 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600747 17:1052438-1052460 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600764 17:1052482-1052504 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600781 17:1052526-1052548 CAGGGTCAGAGGGAGGGTGCCGG + Intronic
1142600799 17:1052570-1052592 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600817 17:1052614-1052636 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600835 17:1052658-1052680 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600852 17:1052702-1052724 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600868 17:1052746-1052768 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600885 17:1052790-1052812 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600902 17:1052834-1052856 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600920 17:1052878-1052900 CAGGGTCAGAGGGAGGGTTCAGG + Intronic
1142600936 17:1052922-1052944 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600952 17:1052966-1052988 CAGGGTCAGAGCGAGGGTTCCGG + Intronic
1142600969 17:1053010-1053032 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142600986 17:1053054-1053076 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601004 17:1053098-1053120 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601022 17:1053142-1053164 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601040 17:1053186-1053208 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601057 17:1053230-1053252 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601074 17:1053274-1053296 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601106 17:1053362-1053384 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601122 17:1053406-1053428 CAGGGTCAGAGGGAGGGTTCCGG + Intronic
1142601133 17:1053449-1053471 CAGGGTCAGAGCGAGGGTTCCGG + Intronic
1143435627 17:6922428-6922450 CAGTGGCAGAGAGAGGTTCGAGG + Intronic
1144064356 17:11611338-11611360 CAGGGTGAGAGAGGCGTTATTGG - Intronic
1144692377 17:17276367-17276389 CAGGGTCAGAGAGAAGTGGGAGG - Intronic
1146430017 17:32784197-32784219 CAGAGACAGAGAGAAGTGGTAGG - Intronic
1147154894 17:38539490-38539512 CAGGGTGAGAGAGAGGTAGGTGG + Intronic
1147419189 17:40313659-40313681 CAGGGTAGGGGAGAGGGTGTTGG - Intronic
1148588403 17:48797333-48797355 CAGGGTCAGAGAGAGGAACAAGG + Intronic
1149291835 17:55225183-55225205 CAGGTTCAGATAGAGATGGTAGG - Intergenic
1151826693 17:76527793-76527815 CAGGGGCAGAGCGAAGTTCTGGG - Exonic
1152146591 17:78572320-78572342 CAGGGTCAGTGAGTGGGAGTGGG - Intronic
1152538162 17:80962225-80962247 CTGGCTCTGAGAGAGCTTGTGGG + Intronic
1152562769 17:81086803-81086825 CAGGGTCACTGAAAGGTTCTTGG + Intronic
1153835058 18:8956182-8956204 CAAGGTCAGAGAGAGAATGCTGG - Intergenic
1154021298 18:10666152-10666174 CAGGGGCAGAGAAAGATTGCTGG - Intergenic
1155403527 18:25463509-25463531 CAGGGCCAGAGAGAGGAAGGAGG - Intergenic
1158038965 18:53069718-53069740 CAGGGTCAGAGAGGGGAGGATGG - Intronic
1160001408 18:75027730-75027752 CAAGGTCAGACAGAGGCTGGTGG + Intronic
1160152555 18:76406168-76406190 CAGGGTAAAAGAGAGGTTTGGGG - Intronic
1160430027 18:78804652-78804674 CAGGGGCAGAGGGAGGCTGCAGG + Intergenic
1161870528 19:6866260-6866282 GAGAGTCAGAGAGAGAGTGTCGG - Intergenic
1162791040 19:13063082-13063104 AGGGGGCAGAGAGAGGTGGTGGG + Intronic
1163235091 19:16025284-16025306 CAGGGTCAGGGACAGCCTGTGGG - Intergenic
1164244987 19:23420966-23420988 CAGGGCCTGGGAGAGGTAGTGGG - Intergenic
1165329657 19:35134519-35134541 CAGGGTCGGAGAGAAGCTGACGG + Exonic
1165832577 19:38736805-38736827 TAGGGACAGAGAGAGGCTGGGGG - Intronic
1165944820 19:39435782-39435804 CAGGGTCTGGGAGAGGTCGGTGG - Intronic
1167234296 19:48304211-48304233 CGGGGTCAGCCAGAGGTTGTGGG + Intronic
1167521756 19:49959631-49959653 CAGGGAAAGAGAGAGGGTGGGGG + Intronic
1167523627 19:49971091-49971113 CAGGGAAAGAGAGAGGGTGGGGG - Intergenic
1168098195 19:54127341-54127363 CAGAGTCAGAGAGAGGTCTGAGG - Intronic
1168118131 19:54236907-54236929 CAGGGATGGAGAGAGGTTGGTGG + Intronic
1168287094 19:55340438-55340460 AGGGGTCAGGGAGAGGTTCTAGG - Intronic
925531415 2:4867329-4867351 CAGGTTGAGGGAGAGGGTGTAGG + Intergenic
927136101 2:20097639-20097661 CTGGGTCAGAGAGCTGTTATGGG - Intergenic
927232676 2:20840274-20840296 CAGAGTCTGAGAAAGGTAGTAGG + Intergenic
927312992 2:21651366-21651388 CGGATTCAGAGAAAGGTTGTGGG + Intergenic
927873063 2:26635966-26635988 CAGGGTTAGAGAGGTGGTGTGGG - Intronic
928203994 2:29271164-29271186 CAGGGTCTGAGGGAGGATGCAGG + Intronic
929460493 2:42099420-42099442 CAGGGTAAGAGAGAGAGAGTGGG + Intergenic
930677393 2:54218068-54218090 CTGGGTGAGATACAGGTTGTGGG - Intronic
932345262 2:70991255-70991277 CAGGGTCAGAAAGTGGTGGCAGG + Intronic
932439281 2:71721575-71721597 CAAGGTCAGGGAGAGGTGGCAGG + Intergenic
934032861 2:88064196-88064218 CAGAGTCAGAGAGATATTGAAGG - Intergenic
934056224 2:88253451-88253473 CAGGGTCAGTGAGAGCTTGGGGG + Intergenic
937267487 2:120625574-120625596 CAGGGTCCTAGAGAAGTTGGAGG - Intergenic
938782167 2:134594266-134594288 CGGGGACAGAGAGAGGGGGTGGG + Intronic
938986556 2:136581957-136581979 GAGGGACAGAGAGAAGTTGGGGG - Intergenic
939041270 2:137191693-137191715 AGGGGTCAGAGAGAGCTTCTTGG - Intronic
940891858 2:159042884-159042906 AAGGGTTTGAGAGAGGTTCTTGG + Intronic
942890077 2:180979040-180979062 CTGGGTCAAAGAGTGCTTGTGGG - Intronic
943917262 2:193651230-193651252 CAGGGTCTGAGAGGGATTGAAGG - Intergenic
944867942 2:203880736-203880758 CAGAGTCAGAGAGAGGGCATTGG + Intergenic
946212976 2:218162366-218162388 CAGGGTCACAGTGAGGTGTTGGG - Intergenic
946379510 2:219335747-219335769 CAGGGCCAGATAGAGGTGCTAGG + Intergenic
946657425 2:221963192-221963214 CAGGGTGAGAGAGAGATGGCTGG + Intergenic
947542496 2:230988585-230988607 GAGGAGCAGAGAGAGGTGGTGGG - Intergenic
948685838 2:239669388-239669410 CAGGGAAAGAGGGAGGTTTTGGG - Intergenic
948932569 2:241141544-241141566 CAGGGTCACTGAGAGGTGGGAGG - Intronic
1169665448 20:8030233-8030255 CAAGTTAAGAGAGAGGATGTAGG + Intergenic
1169951412 20:11048475-11048497 AAGGGAAAGAGAGTGGTTGTGGG - Intergenic
1170474770 20:16703948-16703970 CATGGTCAGAGAAAGGCTCTCGG + Intergenic
1171076049 20:22124597-22124619 CAGGGACAGAGAGACGTGATAGG + Intergenic
1172204499 20:33153295-33153317 CAGGCACAGAAAGAGGGTGTAGG - Intergenic
1172836039 20:37873808-37873830 CAGGGTCACAGACAGGCTGCTGG + Intergenic
1172896622 20:38304723-38304745 CAGGGTCAGAGGGAGAGTGTGGG + Intronic
1173789643 20:45819637-45819659 GAGGGTCAGGGAAAGGTTTTTGG + Intergenic
1174339996 20:49889531-49889553 CAGGGTCAAGGCGAGGTGGTAGG - Exonic
1174402318 20:50282710-50282732 CAGGGACAGAGACAGGTGGGTGG - Intergenic
1174772109 20:53310021-53310043 CATGGTCAGAGAGAGTTGGGAGG - Intronic
1174828031 20:53786692-53786714 CAGGGTAAGTTAGAGGTAGTAGG - Intergenic
1175627576 20:60501469-60501491 CAGGGATAGGGTGAGGTTGTGGG + Intergenic
1176592466 21:8657964-8657986 CAGGGCCAGAGCCAGGGTGTGGG - Intergenic
1176915565 21:14621574-14621596 CAAGGTCACAGAGAGGCTGGGGG + Intronic
1177696220 21:24575919-24575941 AAGGGACAGAGAGAGGCTGTTGG + Intergenic
1178686003 21:34711127-34711149 CAGGGCCAGAGCCAGGTGGTTGG + Intronic
1179044245 21:37830619-37830641 CAGTGCCAGAGAGAAGGTGTGGG + Intronic
1179730230 21:43363610-43363632 CTGGGTCAGAGAGAGGCACTGGG + Intergenic
1180184856 21:46134455-46134477 CAGGGTCAGGGTGAGGGTGAGGG + Intergenic
1180275325 22:10635111-10635133 CAGGGCCAGAGCCAGGGTGTGGG - Intergenic
1181047928 22:20224338-20224360 CAGGGTCAGAGGCAGGCTCTAGG - Intergenic
1182046005 22:27274615-27274637 AAGAGTCAGAAAGAGGTTGCAGG + Intergenic
1183716512 22:39536291-39536313 CCGAGGCACAGAGAGGTTGTGGG - Intergenic
1184328344 22:43809555-43809577 CAGGGACACAGAGAGGTTAAGGG - Intronic
1184462301 22:44646052-44646074 CAAGGTCAGACCGAGGTCGTCGG - Intergenic
1184629253 22:45763142-45763164 CAGGGTGAGGGAGAGGGGGTAGG - Intronic
1185419895 22:50729343-50729365 CAGGGGCAGGGAGAGGGGGTGGG + Intergenic
949500722 3:4677677-4677699 CATGGGCAGAGAGCGATTGTTGG + Intronic
949963276 3:9332473-9332495 CATGGTCAGAGAGTGATTATAGG + Intronic
950266435 3:11576722-11576744 CAGAGTCAGATTGAGGGTGTGGG - Intronic
951369629 3:21829456-21829478 CAGGGTCAGAGAGAAGGGATGGG + Intronic
952818385 3:37465280-37465302 CAGGTTCAGAGCGAGGTGGGCGG + Intronic
953158253 3:40394649-40394671 CAGGGTCAGGGAGAAGTGGGAGG - Intronic
954331896 3:49895631-49895653 CCTGGGCAGAGAGAGGATGTAGG + Intronic
954750283 3:52809699-52809721 GAGGGTCAGAGAGAGGTTCCTGG + Intergenic
954794768 3:53155887-53155909 CAGTGCCAGAGAGAAGTGGTTGG - Intergenic
954871519 3:53770897-53770919 AGGTGTCAGAGAGAGGCTGTTGG - Intronic
955097249 3:55811712-55811734 CATAGTCAGAGAAAGGTTGCTGG - Intronic
955411294 3:58657257-58657279 CAGGGTCAGAGAGATGGGGTTGG + Intronic
955571827 3:60315398-60315420 TAGGGTCAGAGAGAGGCTTCTGG - Intronic
955818451 3:62873120-62873142 CAGGGTGAGAGACAGGAGGTGGG - Intronic
956145115 3:66184213-66184235 CAGTGTCAGAGACAGGTTTTGGG - Intronic
957197534 3:77089373-77089395 CAAGGTCACAGAGATGTTGCAGG + Intronic
958189376 3:90165350-90165372 CAGAGTCAGAGTGAGATTGCAGG + Intergenic
960864716 3:122187621-122187643 AAGGGTCAGGGAAAGGTTCTTGG + Intronic
961505539 3:127368630-127368652 CAGGGGGAGAGTGAGGTTGGGGG - Intergenic
962312315 3:134335347-134335369 TAGGGTCAGAGACAGGATTTTGG - Intergenic
962446184 3:135467938-135467960 CTAGGTCAGACAGAGGTTGAGGG - Intergenic
962565016 3:136649024-136649046 CAGTGTCAGAGAGAGATTGGAGG - Intronic
962982659 3:140504790-140504812 CAGAGCCAGAGAAAGGTGGTAGG + Intronic
964145746 3:153460943-153460965 CAGGGTCAGACAAAAGTGGTGGG - Intergenic
964468855 3:157030133-157030155 CATGGTGAGAGAGAGGTGGGGGG + Intronic
965380211 3:167978963-167978985 CAGGGGCAGTGAGAGGTTTCTGG - Intergenic
965779599 3:172270567-172270589 CAGGGTCAGAGAGACCTTCTTGG + Intronic
967129537 3:186457976-186457998 CCAGGTCAGAGAGAAGTTGCGGG - Intergenic
969290165 4:6233725-6233747 CAGGGACAGAGCGAGGTACTGGG + Intergenic
969520658 4:7676005-7676027 CAGGGTCAGAGCCAGGCTGGGGG - Intronic
969796407 4:9531499-9531521 CAAGGGGAGAGAGGGGTTGTGGG - Intergenic
973300006 4:48570984-48571006 CTGCCTCAGAGAGAGGTTCTGGG + Intronic
974351175 4:60748897-60748919 CAGAGTAAGAGAGAGATTATAGG + Intergenic
975267164 4:72383556-72383578 AGGGGTCAGCCAGAGGTTGTTGG - Intronic
977891661 4:102319251-102319273 CTGGTTCAGAGAGAGGATGAAGG + Intronic
978256131 4:106694718-106694740 GAGGGAGAGAGAGAGGTGGTGGG - Intergenic
981533425 4:145775066-145775088 CAGAGCCAGAGAGAGGTTCCTGG - Intronic
984818925 4:183862792-183862814 CACCGTTAGAGAGAGGTGGTGGG - Intronic
986483877 5:8216108-8216130 AAGGGTAAGGGAGAAGTTGTTGG - Intergenic
990304381 5:54480388-54480410 CAGGATCAGAGTGTGGTTGGGGG + Intergenic
990342378 5:54836146-54836168 AAGGGTCAAAGGGAGCTTGTTGG - Intergenic
991528986 5:67594660-67594682 CAGGCAGAGAGAGAGGTAGTAGG - Intergenic
991575510 5:68099218-68099240 CAGGGTCAGAGGGTGGTTTCAGG + Intergenic
991622503 5:68559423-68559445 CAGGGTCAGGGAGATGGTTTGGG - Intergenic
992032783 5:72739703-72739725 CAGGCCCAGAGAGGGGTTGCTGG + Intergenic
992192977 5:74312318-74312340 CTGGGTCAGAGATCTGTTGTGGG - Intergenic
992479698 5:77138279-77138301 CAGGGCCAGAGGGAAGGTGTAGG - Intergenic
994797949 5:104330648-104330670 CAGGATCAGAGAGAGATCCTGGG + Intergenic
995782554 5:115793933-115793955 CAGGGTCAGATAAATGTTTTTGG + Intergenic
996387722 5:122926290-122926312 CAGGGTGAGTGAGAGGGAGTAGG + Intronic
996391481 5:122967386-122967408 CAGGGTCTGAAAGAGGTTCAAGG - Intronic
996821722 5:127636871-127636893 CTGGGTCAGAGACTGGTTGGAGG - Intergenic
998405566 5:141872704-141872726 CAGGGTGAGAAAGAGCGTGTGGG - Intronic
999572767 5:152939321-152939343 CAGGAGCAGGGAGAGGTTCTTGG + Intergenic
999871881 5:155760207-155760229 CAGGGTGATGGAGAGGGTGTTGG - Intergenic
1000323993 5:160158198-160158220 CAAGGACAGAGAGCGGGTGTAGG + Intergenic
1001063915 5:168519998-168520020 CAGTGGCAGCGAGAGGTTTTGGG + Intergenic
1001101354 5:168817220-168817242 CAAGGTCAGGGTGATGTTGTGGG + Intronic
1001254540 5:170173323-170173345 CAGGGCCAGAGAAAGGCAGTGGG - Intergenic
1001310628 5:170607749-170607771 CAAGGTCACAGAGAGGTTTGTGG + Intronic
1001324004 5:170706725-170706747 AAGGGGCAGAGAGAGGTTGAAGG - Intronic
1001493911 5:172174665-172174687 CATGGTCAGGGAGCGGTGGTCGG + Intronic
1001667156 5:173442803-173442825 CAGGCTCAGGGGGAGGTAGTAGG + Intergenic
1003306418 6:4933234-4933256 CAGGGTTGGAGAGAGGTACTTGG - Intronic
1005714588 6:28534763-28534785 TAGGGCCAGAGATAGGTTTTGGG - Exonic
1006042939 6:31270441-31270463 CATGGTCAGAGAGGGGGTGGTGG + Exonic
1006943031 6:37765544-37765566 CAGGGCCAGAGAGTGGTAGGAGG - Intergenic
1007312122 6:40955022-40955044 CAGGGTCAGGGTGAGGCTGGTGG - Intergenic
1007767486 6:44169622-44169644 CAGGGTCAGAATGGGGTAGTGGG - Intronic
1011617703 6:89212192-89212214 CAGGGTGAGAGAGAAGTTTAGGG - Intronic
1011912377 6:92457117-92457139 CAGGGACAGAGAGAGACTGATGG + Intergenic
1013305254 6:108841737-108841759 CAGGGTTAGGGAGAGGCTGGAGG - Intergenic
1014640206 6:123899953-123899975 CATGGTCAGAGAGAGATGCTTGG - Intronic
1015185306 6:130408933-130408955 CAGGGTCAGGGAGGGGGTGGTGG - Intronic
1017852902 6:158320858-158320880 CAGGGTCAGAGAAAGCATATCGG - Intronic
1019149294 6:169993640-169993662 CAGGGTGAGGGAGTGGCTGTGGG - Intergenic
1019175609 6:170157870-170157892 CTGGGTCACAGAGAGATGGTGGG + Intergenic
1019175672 6:170158203-170158225 CTGGGTCACAGAGAGATGGTGGG + Intergenic
1019848673 7:3532289-3532311 GAGGCTCAGAGTGAGGGTGTAGG + Intronic
1022440796 7:30431155-30431177 CAGGGTCAGAAAGAGAGTCTTGG - Intronic
1023205732 7:37747554-37747576 AAGGGCAAGAGAGAGGCTGTAGG + Intronic
1024004747 7:45217094-45217116 CAGGCTCAGAGAGGGGATCTGGG + Intergenic
1024291424 7:47807373-47807395 AGGGGTGAGAGGGAGGTTGTGGG + Intronic
1026144928 7:67738478-67738500 CAGGGGCAGAGAGAGTTGGAGGG - Intergenic
1026161275 7:67870869-67870891 CAGGGACAGAGTCAGGTTTTGGG + Intergenic
1026373058 7:69721174-69721196 AAAGATCAGAGAGAGATTGTGGG - Intronic
1026829221 7:73600928-73600950 CAGGGTCAGAGAAAGGTGCCCGG - Intronic
1027226686 7:76248162-76248184 CAGGGGCACAGAGAGGGTGAAGG - Intronic
1029121424 7:98270679-98270701 CTGGGCCAGAGAGAGGATGGGGG + Intronic
1029658271 7:101941932-101941954 CAGGGACAGAGAGAGGGGGAGGG - Intronic
1029900908 7:104037982-104038004 CAGGGTGAGAGAGAGGAAATGGG + Intergenic
1030186444 7:106766600-106766622 CAGGGGCAGAGAGAGGGGGTGGG + Intergenic
1030382771 7:108831635-108831657 CAGGGTCACATAGCTGTTGTTGG + Intergenic
1031943299 7:127812593-127812615 CAGGGTCACGGAGAAGTTGAGGG + Intronic
1033285654 7:140038708-140038730 CAGGGACAGAGGGAGTTAGTTGG - Intronic
1033414181 7:141147722-141147744 CAGCGAGAGAGACAGGTTGTGGG + Intronic
1034588753 7:152120484-152120506 GAGGGTCAGCCAGAGGCTGTCGG + Intronic
1035470710 7:159107002-159107024 GAGGTGCAGAGAAAGGTTGTGGG + Intronic
1035552325 8:538368-538390 CTGGGTCAGATAGAGTCTGTTGG + Intronic
1035610117 8:956382-956404 CAGGGTCACAGTGAGTGTGTGGG + Intergenic
1035665431 8:1376641-1376663 CGGGGTCAGAGTGAGGGTCTTGG - Intergenic
1037764451 8:21763708-21763730 CAGGGTCTGGGAGAGGTTGAGGG - Intronic
1038388237 8:27169584-27169606 CAGGGTCAAAGAGATGATGGGGG + Intergenic
1038692190 8:29773704-29773726 CCGGGGCAGAGAGAGGGAGTGGG + Intergenic
1039733333 8:40303731-40303753 CAGGGTCAGAGACATGGTTTGGG + Intergenic
1039956608 8:42212122-42212144 CAGTGCCAGAGAGAGAGTGTTGG - Intergenic
1041095176 8:54342614-54342636 CAGGGTCTGAGAGAACTGGTGGG + Intergenic
1041316219 8:56565141-56565163 ATGAGTCAGAGAGAGGTTGGGGG - Intergenic
1042770857 8:72380798-72380820 CAGTGACAGAGAGAGGTGGAGGG + Intergenic
1043612524 8:82083042-82083064 CAGAGTCAGGGAGAGGTGATTGG + Intergenic
1044264544 8:90166441-90166463 GAGGATCAGAGAAAGGTTTTAGG + Intergenic
1044699687 8:94954531-94954553 AAGGGTTAGAGAGAAGTTGGTGG + Intronic
1045267220 8:100629962-100629984 CAGGGTCACAGACATGTTATGGG + Intronic
1045490139 8:102661930-102661952 GAGGGCCACAGAGAGGTAGTGGG + Intergenic
1046264969 8:111818758-111818780 CAGAGTCACAGAGAGTCTGTTGG + Intergenic
1047505920 8:125480121-125480143 CAGAGACAGAGAGAGGTGGGGGG - Intergenic
1047553142 8:125898584-125898606 CAAAGTTAGGGAGAGGTTGTAGG + Intergenic
1048178637 8:132175387-132175409 AAGAGTCAGAGAGAGGTGGAGGG - Intronic
1048313005 8:133340353-133340375 CAGAGACATAGAGAGGTTATAGG - Intergenic
1048443214 8:134475296-134475318 CAAGGTCAGAGACAGGGTGGAGG - Intergenic
1049110164 8:140637276-140637298 CAGGGGCAGAGAGAGAGGGTGGG - Intergenic
1049201650 8:141343419-141343441 CAGGGTGGGAGAGAGGTTGTGGG + Intergenic
1049285657 8:141773788-141773810 CAGGGTCAGAGAGAGGCAGTGGG - Intergenic
1049391179 8:142372510-142372532 CAGGGACAGACAGAGGCTGCGGG + Intronic
1049422347 8:142522612-142522634 AAGGAGCAGAGAGAGGGTGTTGG - Intronic
1049700006 8:144006366-144006388 CAGAGGCACAGAGAGGTTGGGGG + Intronic
1049784368 8:144443591-144443613 CAGGGTCAGGGAGAGCTTTTGGG + Intronic
1050513472 9:6417893-6417915 CAGAGTCAGAGTGACGTTGAGGG - Intronic
1051060087 9:13035773-13035795 CTGGGTCATAGGGAAGTTGTAGG + Intergenic
1051109576 9:13620619-13620641 GAGGGACAGAGAGAATTTGTGGG - Intergenic
1051280031 9:15433549-15433571 CAGGGTTAGAAAAAGGTTCTTGG + Exonic
1052077869 9:24166464-24166486 CAGGGACAGAGAGTGGGGGTAGG - Intergenic
1053442056 9:38124856-38124878 GAGGGGCAGAGAGAGGTGGAGGG - Intergenic
1057042909 9:91860185-91860207 AAGGGTGAGAGAGAAGCTGTGGG + Intronic
1057481373 9:95447745-95447767 CAGGGTCGGGGGCAGGTTGTGGG - Intronic
1060522574 9:124302005-124302027 CAGGGTGTGGCAGAGGTTGTTGG - Exonic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061252756 9:129436347-129436369 CAGAATCAGAGGAAGGTTGTTGG + Intergenic
1061645688 9:131999219-131999241 CAGGGTAAGAGAGAGTTGGAAGG + Intronic
1061675943 9:132215716-132215738 CAGGCTCTGAGAGAGGCTCTGGG + Intronic
1062281403 9:135753556-135753578 CATGGCCAGAGAGAGCATGTGGG - Intronic
1062597121 9:137304410-137304432 CGGGGTCAGGCAGAGGTGGTGGG + Intergenic
1187189129 X:17016249-17016271 AAGGGTCAGATAGACTTTGTGGG + Intronic
1187294306 X:17984280-17984302 CAGAGTCAGAGACAGGTTTGAGG - Intergenic
1189268514 X:39734374-39734396 CAGGTTCAGAGAGGTTTTGTAGG - Intergenic
1190108482 X:47574669-47574691 CAGGGTAAGCGAGAGGCTGGCGG - Exonic
1192183477 X:68930605-68930627 CAGGGAGGGAGAGAAGTTGTGGG - Intergenic
1193899150 X:87154094-87154116 GAGAGAAAGAGAGAGGTTGTAGG + Intergenic
1197130533 X:123000780-123000802 CAGTGTGAGAGACAGGTAGTTGG - Intergenic
1199060393 X:143349546-143349568 CAGGGTCAGGGAGAGATTAAAGG + Intergenic
1199470384 X:148189030-148189052 CAGGGTAACAGAAAGGTTGAAGG - Intergenic
1199592486 X:149480204-149480226 CAGGATCAAAGAGAGATTTTAGG + Intergenic
1200841602 Y:7786744-7786766 CAGGGTCAGAGATAGGAAGGAGG - Intergenic
1201289612 Y:12410296-12410318 CAGGATTAGATAGAGGTGGTGGG - Intergenic