ID: 901768819

View in Genome Browser
Species Human (GRCh38)
Location 1:11520392-11520414
Sequence CCTCATAGTTTATGACGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901768819_901768824 9 Left 901768819 1:11520392-11520414 CCAGCTCGTCATAAACTATGAGG 0: 1
1: 0
2: 0
3: 1
4: 55
Right 901768824 1:11520424-11520446 GTGGTGGCCGCCTCTTGTCCAGG 0: 1
1: 0
2: 6
3: 93
4: 666
901768819_901768822 -10 Left 901768819 1:11520392-11520414 CCAGCTCGTCATAAACTATGAGG 0: 1
1: 0
2: 0
3: 1
4: 55
Right 901768822 1:11520405-11520427 AACTATGAGGTGCTCTGAGGTGG 0: 1
1: 0
2: 2
3: 15
4: 126
901768819_901768823 -7 Left 901768819 1:11520392-11520414 CCAGCTCGTCATAAACTATGAGG 0: 1
1: 0
2: 0
3: 1
4: 55
Right 901768823 1:11520408-11520430 TATGAGGTGCTCTGAGGTGGTGG 0: 1
1: 0
2: 0
3: 15
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901768819 Original CRISPR CCTCATAGTTTATGACGAGC TGG (reversed) Intronic
900089287 1:912721-912743 CCTCATAGTTCAGGAGGGGCAGG - Intergenic
901768819 1:11520392-11520414 CCTCATAGTTTATGACGAGCTGG - Intronic
909875476 1:80797516-80797538 CTTCATAATTTATGAAGAACAGG + Intergenic
922353327 1:224753561-224753583 TCTCATAGTTTCTGAGGACCAGG + Intergenic
923501916 1:234572166-234572188 CCTCCTAGATTATGAGCAGCTGG + Intergenic
1067080062 10:43207747-43207769 CCCCAGAGTTTCTGACCAGCAGG - Intronic
1068846504 10:61682259-61682281 TCTCATAGTTTATGAGGAGTTGG - Intronic
1069294723 10:66829790-66829812 CCTCATAGTTTCTGATCAGTAGG - Intronic
1077791995 11:5450993-5451015 CCTCACAGTTTATGGAGACCAGG - Intronic
1078276892 11:9857252-9857274 CCTTATAGCTTGTGAAGAGCTGG + Intronic
1084145237 11:67261679-67261701 CCTCAGAGTTTTTGCCGAGACGG - Intergenic
1087014060 11:93539230-93539252 TCTCATTGATTATGAAGAGCTGG - Intronic
1088396538 11:109376014-109376036 CCTCATAGTGTATGCTGAGTAGG + Intergenic
1089388619 11:118084896-118084918 CCTCAGAGTTCAGGAGGAGCAGG + Intronic
1090716247 11:129433803-129433825 CATCATAGTTTATCACTACCTGG + Intronic
1094503565 12:31041418-31041440 TCTCATTGTCTATGACGTGCTGG + Intergenic
1098171752 12:67753869-67753891 GCTCACAGTTTAGGAAGAGCTGG - Intergenic
1103066541 12:117903230-117903252 TCTCATACTTTATGACCATCTGG + Intronic
1105720989 13:23114210-23114232 CCTCATAGAGGATGAGGAGCTGG + Intergenic
1112241235 13:97683639-97683661 CCTCATAGTCTCTGTGGAGCAGG - Intergenic
1115620992 14:35140112-35140134 CCTCAAAATTTATGTCTAGCAGG - Intronic
1119640255 14:76309522-76309544 CCTCATAGTTTCTGATAACCTGG + Intergenic
1142488902 17:265057-265079 CCTCATACTTTATGAGAAGAGGG + Intronic
1143178895 17:4972342-4972364 CCTCATAGTCCATGAGGAGTAGG + Exonic
1157479794 18:48046109-48046131 CCTCATAGTTTCTGTGGATCAGG - Intronic
1157690992 18:49681610-49681632 CCTCATAGGTTGTGAAGAGAAGG - Intergenic
1164906622 19:31973496-31973518 CCTCATGGTGTTTGACCAGCAGG - Intergenic
931773038 2:65515921-65515943 CCTCACAGCTTATGACCAGAGGG - Intergenic
1175744933 20:61449543-61449565 CCTAATAGTGTATGAAGAGAAGG + Intronic
1177903698 21:26949304-26949326 CCTCATACCTTCTGACTAGCTGG + Intronic
1178075121 21:29008502-29008524 GCTCATAGTGAATGACCAGCTGG - Exonic
1181381342 22:22507273-22507295 CCTCATAGTTTTTGAAGGTCTGG - Intronic
950172337 3:10847655-10847677 CCTCATCATTAATAACGAGCTGG - Intronic
953200009 3:40770138-40770160 CCTCAGAGTTTCTGATGAGTAGG - Intergenic
957133907 3:76259959-76259981 TTTCATAGTTTATGACAATCTGG + Intronic
965367347 3:167816979-167817001 CCTTATAGTTTATACTGAGCAGG + Intronic
975566006 4:75754885-75754907 CCTCATAGTTTCTGTGGATCAGG + Intronic
975775001 4:77776897-77776919 CTTCTTTGTTTATGACCAGCAGG - Intronic
990669339 5:58109958-58109980 ACTCATCGTTTCTGAAGAGCCGG - Intergenic
993881691 5:93370463-93370485 CCTCATAGGTCATGAAGTGCCGG - Intergenic
998529423 5:142871220-142871242 CCTGTTAGCTTATGACCAGCAGG - Intronic
1002932144 6:1642086-1642108 CCCCTTAGTTTCTGAAGAGCAGG - Intronic
1009485721 6:64219330-64219352 CCTCTTAGTTTGTGACAACCTGG - Intronic
1018130335 6:160724634-160724656 CAGCATAGTTTCTGACGAGAAGG - Intronic
1020688446 7:11325380-11325402 CTTAATAGTTTATGAGAAGCTGG + Intergenic
1030910822 7:115246725-115246747 CCTGATAGGATATGATGAGCAGG - Intergenic
1038178448 8:25203137-25203159 CCTCATATTCTATGATGATCTGG - Intronic
1038947346 8:32375781-32375803 CCTCATAGTGTATTAAGGGCTGG + Intronic
1042632685 8:70837065-70837087 CCTCTAGGTCTATGACGAGCGGG + Intergenic
1043436812 8:80243114-80243136 CCTCATAATTTATGATAAGAAGG + Intergenic
1050602862 9:7270213-7270235 CCTCCTAGTTTCTGACGCTCTGG + Intergenic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1192247141 X:69382986-69383008 CCTCATAGTTTATATCTTGCTGG + Intergenic
1194293071 X:92099296-92099318 TCTCACAGTTTCTGACAAGCTGG - Intronic
1195040964 X:101013875-101013897 CCCCAGAGTTTAAGACCAGCTGG + Intronic
1195120680 X:101748391-101748413 CTTCATAGTTTATGAAGAAAAGG - Intergenic
1200610581 Y:5323844-5323866 TCTCACAGTTTCTGACAAGCTGG - Intronic