ID: 901771231

View in Genome Browser
Species Human (GRCh38)
Location 1:11531358-11531380
Sequence GTCACCACCGGGGTGTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901771222_901771231 -1 Left 901771222 1:11531336-11531358 CCCCACAGCCAATGTGGATGAGG 0: 1
1: 0
2: 1
3: 26
4: 154
Right 901771231 1:11531358-11531380 GTCACCACCGGGGTGTCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 106
901771220_901771231 10 Left 901771220 1:11531325-11531347 CCAGGGGCTGGCCCCACAGCCAA 0: 1
1: 0
2: 1
3: 30
4: 386
Right 901771231 1:11531358-11531380 GTCACCACCGGGGTGTCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 106
901771224_901771231 -2 Left 901771224 1:11531337-11531359 CCCACAGCCAATGTGGATGAGGT 0: 1
1: 0
2: 1
3: 12
4: 155
Right 901771231 1:11531358-11531380 GTCACCACCGGGGTGTCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 106
901771225_901771231 -3 Left 901771225 1:11531338-11531360 CCACAGCCAATGTGGATGAGGTC 0: 1
1: 0
2: 0
3: 13
4: 123
Right 901771231 1:11531358-11531380 GTCACCACCGGGGTGTCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 106
901771226_901771231 -9 Left 901771226 1:11531344-11531366 CCAATGTGGATGAGGTCACCACC 0: 1
1: 0
2: 1
3: 10
4: 91
Right 901771231 1:11531358-11531380 GTCACCACCGGGGTGTCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 106
901771215_901771231 29 Left 901771215 1:11531306-11531328 CCAAAATTAGGGGGCGGGGCCAG 0: 1
1: 0
2: 0
3: 8
4: 68
Right 901771231 1:11531358-11531380 GTCACCACCGGGGTGTCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901771231 Original CRISPR GTCACCACCGGGGTGTCCCT GGG Intronic
901771231 1:11531358-11531380 GTCACCACCGGGGTGTCCCTGGG + Intronic
902626546 1:17679913-17679935 GTCACCACCGAGCTGGCCCTGGG - Intronic
903972228 1:27126443-27126465 GTCACCATCAGCTTGTCCCTTGG + Intronic
904462657 1:30689397-30689419 GTCCCCAGCTGGGAGTCCCTGGG - Intergenic
906528171 1:46508547-46508569 GTCACCACCAGGTTGTGCATAGG - Intronic
908260839 1:62338475-62338497 GTCACCACTGGGGGCTCCCAGGG - Intergenic
918313906 1:183306812-183306834 GTCACCAGCTGGGTGACCTTGGG + Intronic
920181703 1:204135889-204135911 GTCTCCACCGGTGTGTGCCCAGG - Intronic
920560067 1:206932521-206932543 GTCTCCACCCTGGTGCCCCTGGG - Exonic
921218784 1:212958597-212958619 ATCCCCAGAGGGGTGTCCCTAGG - Intronic
922803151 1:228373174-228373196 GACACCAGCGGGGGGCCCCTGGG - Intronic
923310462 1:232729764-232729786 ATCATCACTGGGATGTCCCTTGG + Intergenic
1063115748 10:3070084-3070106 GTCACACCTGGGCTGTCCCTGGG + Intronic
1069713790 10:70507965-70507987 CCCACCACAGGGGTCTCCCTGGG - Intronic
1072625076 10:97106054-97106076 GTTACCACTGGGAAGTCCCTGGG - Intronic
1073066452 10:100762284-100762306 GTCCACACCGGGGTTTCACTGGG + Intronic
1076493455 10:130879895-130879917 GTCACCACCAGGGTCCCCCAGGG + Intergenic
1076523344 10:131094757-131094779 GTAACCACCTTGGTGTACCTTGG + Intronic
1076603463 10:131674308-131674330 GTCTCCACAGGGGGATCCCTGGG - Intergenic
1077122911 11:918707-918729 GTCTGCACAGGGTTGTCCCTAGG - Intergenic
1077579657 11:3408607-3408629 GTCACCACCTGGCTGACCCCAGG - Intergenic
1079156274 11:17950839-17950861 GTCAGCTCCAGGGTGACCCTGGG + Intronic
1081540745 11:44032908-44032930 GTCTCCACCCGCGTCTCCCTCGG - Intergenic
1083264046 11:61537959-61537981 GCCACCTCGGTGGTGTCCCTGGG - Intronic
1084236672 11:67792128-67792150 GTCACCACCTGGCTGACCCCAGG - Intergenic
1084767453 11:71322023-71322045 GTCACCCCCTGGTGGTCCCTGGG - Intergenic
1090256744 11:125289801-125289823 CTCACCACTGGCGTGTCACTCGG + Intronic
1092407580 12:8231559-8231581 GTCACCACCTGGCTGACCCCAGG - Intergenic
1096469803 12:51869046-51869068 GGAAGCACGGGGGTGTCCCTCGG - Intergenic
1101065665 12:101017641-101017663 GTCACCACAGGGGTAGCCTTTGG + Intronic
1106949965 13:34872376-34872398 AGCAACACCGGGATGTCCCTAGG + Intergenic
1113577660 13:111405406-111405428 GACACCACCTGGGTGTCCAATGG - Intergenic
1118885220 14:69860323-69860345 TTCTGCACCGGGGTTTCCCTGGG + Intronic
1119080132 14:71685082-71685104 GCCACCCCCAGGGTGTCCGTGGG + Intronic
1119921688 14:78452445-78452467 GTCACCATCTGGGTGTCACTGGG - Intronic
1131630975 15:94176460-94176482 CTCACCACTGTGCTGTCCCTTGG + Intergenic
1132181029 15:99752990-99753012 GTCACCTCTGTGGTGCCCCTGGG + Intergenic
1133348282 16:5084671-5084693 GTCACCACCTGGCTGACCCCAGG - Exonic
1133477883 16:6140915-6140937 TTGACCACTGGAGTGTCCCTTGG - Intronic
1135474829 16:22764820-22764842 GTCACCACGGGGGAGCTCCTGGG - Intergenic
1137290452 16:47048959-47048981 GTCACCACTGGGGTGCCTCAGGG - Intergenic
1138347709 16:56330185-56330207 CTGACCACCAGGGTGTCCCTGGG - Intronic
1139492294 16:67292786-67292808 TTCTCCACCTGGATGTCCCTCGG + Intronic
1139682387 16:68575146-68575168 GTCCCCACCTGGGCCTCCCTTGG + Intronic
1140932080 16:79636995-79637017 GTCACCACCAGAATGTCCCTTGG - Intergenic
1141173093 16:81703652-81703674 GGCACCAGCGGGGTGTTCCAAGG - Intronic
1141673128 16:85503250-85503272 GTCACCACACGGGTGTCTCACGG + Intergenic
1142350544 16:89577358-89577380 GTGACCCCCAGGGTGGCCCTCGG + Intronic
1147582253 17:41634111-41634133 GTGACAACCAGGGTGTCCATGGG + Intergenic
1150628464 17:66858924-66858946 GTCACCACAAGGCTGTGCCTTGG - Intronic
1151241001 17:72757814-72757836 GTATCCACCGTGGTGTCCCCTGG + Intronic
1152174887 17:78781496-78781518 GTCCCCACCGCGGTGCCCCTCGG + Intronic
1157217107 18:45793395-45793417 GTCACCACCTGTGTGCCCTTGGG + Intergenic
1158256276 18:55552577-55552599 GTCAGCACTGGTGTGTCCCGTGG - Intronic
1158892917 18:61889768-61889790 GCCACCTCCTGGGTGGCCCTAGG + Intronic
1159960990 18:74555601-74555623 GACTCCACCTGGGTGTCCTTGGG - Intronic
1163291354 19:16381367-16381389 CCCACCACTGGGGTGGCCCTCGG - Intronic
1163323217 19:16586650-16586672 CTCCCCACCGGGCTGGCCCTGGG + Intronic
1166194887 19:41198942-41198964 GTCCCCAGCCAGGTGTCCCTGGG + Intronic
1166315546 19:41987589-41987611 ATCAGCAGCGGGGTGTGCCTGGG + Intronic
1167044646 19:47042555-47042577 GTCACCACCTGGGTGTCCTCTGG - Intronic
925034081 2:672757-672779 GTCCCTGCAGGGGTGTCCCTGGG - Intronic
925858100 2:8149856-8149878 GTCTCCACCGTGGTGTCTGTGGG + Intergenic
932449118 2:71798507-71798529 GTGACCACCAGGGGGACCCTGGG - Intergenic
934117635 2:88811862-88811884 CTCTCCATCAGGGTGTCCCTGGG + Intergenic
934477623 2:94603817-94603839 GTCATCATCAGGGTGTCCCATGG + Exonic
937330040 2:121020987-121021009 CTCTCCACCAGAGTGTCCCTAGG - Intergenic
941699709 2:168591687-168591709 TTCACCTTCGGGGTGTTCCTTGG + Intronic
945075151 2:206031515-206031537 ATCACCACCTCAGTGTCCCTTGG + Intronic
948940140 2:241191303-241191325 GACACCACGGGGGTGCCCCCAGG + Intronic
1172637515 20:36419923-36419945 GGGACCACCGGGGTGTATCTTGG + Intronic
1175159816 20:56999868-56999890 CTCACCAGCTGGGTGTCCTTGGG + Intergenic
1175825972 20:61936732-61936754 GTCAGCAGCGCGGAGTCCCTGGG - Exonic
1176079986 20:63267654-63267676 GGCACCATGGGGGTGCCCCTTGG - Intronic
1180079135 21:45478322-45478344 GTCTTCACCGGGGTCGCCCTGGG - Exonic
1180629105 22:17214972-17214994 GTCACCCCTGAGGTGTCCTTAGG - Intronic
1183172010 22:36195267-36195289 GGCATCACCGGGGTGCCCCAAGG + Intronic
1184147558 22:42620202-42620224 TTGGCCTCCGGGGTGTCCCTTGG + Intronic
1184479876 22:44740119-44740141 GGCATCACCGGGGTGTCCAGTGG + Intronic
950198041 3:11023186-11023208 TCCACCTCCCGGGTGTCCCTGGG - Intronic
954444086 3:50537320-50537342 GTCACCCCGGGGGAGCCCCTGGG + Intergenic
957052629 3:75421933-75421955 GTCACCACCTGGCTGACCCCAGG - Intergenic
959269019 3:104181152-104181174 CTCACAGCTGGGGTGTCCCTGGG + Intergenic
960937337 3:122912101-122912123 ATCCCCACCAGGGGGTCCCTGGG - Intronic
961302217 3:125929624-125929646 GTCACCACCTGGCTGACCCCAGG + Intronic
968995434 4:3942311-3942333 GTCACCACCTGGCTGACCCCAGG - Intergenic
969758558 4:9166485-9166507 GTCACCACCTGGCTGACCCCAGG + Intergenic
969818522 4:9703935-9703957 GTCACCACCTGGATGACCCCAGG + Intergenic
993521035 5:88900837-88900859 GTCACCACCTTGGTGACCTTTGG + Intronic
993873341 5:93277448-93277470 GGCACCACCGGGACATCCCTGGG - Intergenic
997462559 5:134063707-134063729 GTCACTGCCAGAGTGTCCCTAGG + Intergenic
997899139 5:137747988-137748010 GTCACCAGCTGGGGGTCCTTGGG + Intergenic
1006373296 6:33658449-33658471 GTGATCACCAGGGTGTCCATGGG + Intronic
1006931541 6:37692014-37692036 GTACCCACCCCGGTGTCCCTAGG - Intronic
1007346842 6:41237248-41237270 GTCACCACCGGGGAGTTCAGGGG - Exonic
1007826828 6:44607134-44607156 TTCTCCACCGTGGTGCCCCTTGG + Intergenic
1007914331 6:45546949-45546971 GTCACCTCAGGCATGTCCCTCGG + Exonic
1009879468 6:69547579-69547601 CTCACCTCCCGGGTCTCCCTGGG + Intergenic
1016392450 6:143588484-143588506 GACACCACCAGAGTGTCACTAGG + Intronic
1023137448 7:37066443-37066465 GTGGCCACTGGGTTGTCCCTTGG + Intronic
1023393683 7:39733222-39733244 GTCGCCTCCAGGGTGTCCCAAGG - Intergenic
1023843294 7:44108314-44108336 ACCCCCACAGGGGTGTCCCTAGG + Intronic
1026094916 7:67339164-67339186 GTCACCACCTTGGTGACCTTTGG - Intergenic
1032306308 7:130734473-130734495 GTCGCCAGCTGGGTGTCCCGCGG + Intergenic
1034254297 7:149715874-149715896 GTCTGAACCAGGGTGTCCCTAGG - Intronic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1047870249 8:129074511-129074533 GTCACTACCAAGGTGTGCCTGGG + Intergenic
1052852338 9:33385739-33385761 GTCATCATCGGGGTGTCCCTTGG - Exonic
1053930427 9:43110601-43110623 GTCATCATCAGGGTGTCCCATGG - Intergenic
1056787970 9:89606072-89606094 GTCCCCGCCGGGCTGTCACTCGG - Exonic
1189617312 X:42796957-42796979 GTAACCACCTGTGTGACCCTGGG - Intergenic
1192223027 X:69210289-69210311 GTCGCCAGCAGGGTGGCCCTTGG + Intergenic
1195904669 X:109831794-109831816 TTTACCACCTGTGTGTCCCTGGG - Intergenic
1201528639 Y:14965355-14965377 CTCCCCACCTGTGTGTCCCTAGG + Intergenic