ID: 901772515

View in Genome Browser
Species Human (GRCh38)
Location 1:11537463-11537485
Sequence TTTTGGGGGATGGCCCCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 368}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901772506_901772515 -1 Left 901772506 1:11537441-11537463 CCCACCTGACTCTGAGTGGATGT 0: 1
1: 0
2: 0
3: 13
4: 144
Right 901772515 1:11537463-11537485 TTTTGGGGGATGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 18
4: 368
901772501_901772515 25 Left 901772501 1:11537415-11537437 CCTCATGGATCTAAGCCCCTGTC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 901772515 1:11537463-11537485 TTTTGGGGGATGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 18
4: 368
901772507_901772515 -2 Left 901772507 1:11537442-11537464 CCACCTGACTCTGAGTGGATGTT 0: 1
1: 0
2: 0
3: 10
4: 140
Right 901772515 1:11537463-11537485 TTTTGGGGGATGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 18
4: 368
901772504_901772515 8 Left 901772504 1:11537432-11537454 CCTGTCTTTCCCACCTGACTCTG 0: 1
1: 0
2: 5
3: 58
4: 404
Right 901772515 1:11537463-11537485 TTTTGGGGGATGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 18
4: 368
901772503_901772515 9 Left 901772503 1:11537431-11537453 CCCTGTCTTTCCCACCTGACTCT 0: 1
1: 0
2: 3
3: 56
4: 423
Right 901772515 1:11537463-11537485 TTTTGGGGGATGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 18
4: 368
901772508_901772515 -5 Left 901772508 1:11537445-11537467 CCTGACTCTGAGTGGATGTTTTG 0: 1
1: 0
2: 1
3: 6
4: 138
Right 901772515 1:11537463-11537485 TTTTGGGGGATGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 18
4: 368
901772502_901772515 10 Left 901772502 1:11537430-11537452 CCCCTGTCTTTCCCACCTGACTC 0: 1
1: 0
2: 2
3: 47
4: 455
Right 901772515 1:11537463-11537485 TTTTGGGGGATGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 18
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901772515 Original CRISPR TTTTGGGGGATGGCCCCTGT GGG Exonic
901772515 1:11537463-11537485 TTTTGGGGGATGGCCCCTGTGGG + Exonic
903089221 1:20895159-20895181 TTTTGGGATTTGGCCCATGTTGG - Intronic
903127177 1:21256138-21256160 GTTTGGGGTATGGGCCCTGCAGG - Exonic
904375318 1:30077749-30077771 TTTTGGGGGCTGGTTCCTATTGG - Intergenic
904398067 1:30236375-30236397 TTTTGGGTGAAGGCCTCTGTTGG + Intergenic
904554018 1:31345876-31345898 TGTTGGGGGAGGGACCTTGTGGG - Intronic
904616712 1:31753950-31753972 TTTTTAGGGAGGGCCCCTGTAGG - Intronic
904950990 1:34238629-34238651 TGTTGTGGGAGGGACCCTGTAGG + Intergenic
905475450 1:38223915-38223937 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
906715941 1:47969361-47969383 TCTTGGAGGATGGCACCTGGGGG - Intronic
906758863 1:48352275-48352297 TGTTGTGGGAGGGACCCTGTGGG - Intronic
907610496 1:55865088-55865110 TGTTGGGGGAGGGCCCTGGTGGG + Intergenic
908101521 1:60796247-60796269 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
911355850 1:96819332-96819354 TTATGGGGAATAGCCCCTGAAGG - Intronic
911407970 1:97465471-97465493 TGTTGTGGGAGGGACCCTGTGGG + Intronic
911681168 1:100717542-100717564 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
911695739 1:100889337-100889359 TGTTGTGGGATGGACCCAGTGGG - Intronic
911785179 1:101937438-101937460 TGTTGTGGGAGGGCCCCGGTGGG + Intronic
912990605 1:114482650-114482672 TGTTGGAGGAGGGCCCCGGTGGG + Intronic
914523594 1:148440021-148440043 TGTTGGGGGAGGGACCCAGTGGG + Intergenic
917165587 1:172108844-172108866 CTGTGATGGATGGCCCCTGTGGG + Intronic
918041443 1:180916424-180916446 TCTTGGGGGATGACCACTCTTGG - Exonic
918110349 1:181450232-181450254 TGTTGGGGGAGGGCACCTGGTGG - Intronic
919418472 1:197341107-197341129 TGTTATGGGATGGACCCTGTGGG - Intronic
920800369 1:209182190-209182212 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
921032322 1:211344626-211344648 TTTTGAGGGAAGGCCTCTTTAGG + Intronic
923618715 1:235559574-235559596 TGTTGGCGGATGGCCTGTGTGGG + Intronic
923707856 1:236359799-236359821 TGTTGTGGGAGGGACCCTGTAGG - Intronic
923915584 1:238500149-238500171 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1063064140 10:2591448-2591470 TGTTGGGGGAGGAACCCTGTGGG + Intergenic
1064014649 10:11762815-11762837 TTGTGGGAGGTGGCCCCAGTGGG + Intronic
1064638803 10:17395037-17395059 TGTTGTGGGAAGGACCCTGTCGG + Intronic
1064777213 10:18792232-18792254 TGTTGTGGGATGGACCCAGTGGG - Intergenic
1065467278 10:26037907-26037929 GTTGGGGGGAGGGACCCTGTGGG - Intronic
1065970131 10:30799429-30799451 TTATTGGCTATGGCCCCTGTGGG - Intergenic
1066033273 10:31451785-31451807 TTTGGGAGGATGGCTCTTGTTGG + Intronic
1067580704 10:47443779-47443801 GGTTAGGGGATGGCCACTGTGGG + Intergenic
1068378012 10:56210489-56210511 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1069145012 10:64880737-64880759 ATTTGGGGCATGCCACCTGTGGG + Intergenic
1069709785 10:70480799-70480821 CTGTGGGGGATGCCCCGTGTGGG + Intronic
1072122972 10:92420223-92420245 TTTCTGGGGCTGGCACCTGTTGG - Intergenic
1074609604 10:115008932-115008954 TGTTGTGGGAGGGCCCCGGTGGG - Intergenic
1075544873 10:123347530-123347552 TTTTGGGGACTGGCCCCCCTTGG + Intergenic
1076116280 10:127903939-127903961 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1076118252 10:127916219-127916241 TGTTGGGGGAGGGACCTTGTAGG + Intronic
1076335121 10:129701786-129701808 TTAAGGGAAATGGCCCCTGTTGG - Intronic
1076926676 10:133494083-133494105 TTTTGTGGGAGGGACCCAGTGGG - Intergenic
1077013756 11:391113-391135 CTGAGGGGTATGGCCCCTGTAGG - Intergenic
1077641741 11:3887618-3887640 TTTTGGGGTATGGCTGCTTTAGG + Intronic
1078334826 11:10455334-10455356 TTTTAGAGGATTGCTCCTGTGGG + Intronic
1079834033 11:25308665-25308687 TTTTGGAGGACGGACCTTGTGGG + Intergenic
1080232656 11:30035250-30035272 TTTTGTGGGAGGGACCCAGTGGG - Intergenic
1080639213 11:34148988-34149010 TTTCAGGGGATTGCCCCTGAGGG + Intergenic
1080882645 11:36337163-36337185 TTTGGGGGGATGACCCATGGGGG - Intronic
1080975540 11:37335463-37335485 TGTTGTGGGATGGACCCAGTGGG + Intergenic
1081188135 11:40070441-40070463 TTTTGTGGGAGGGACCCGGTGGG - Intergenic
1081323812 11:41721624-41721646 TGTTGTGGGAAGGACCCTGTGGG + Intergenic
1081419830 11:42862903-42862925 TTCTGGAGCATGGCCCCTCTAGG + Intergenic
1081738094 11:45418738-45418760 TGTTGTGGGAGGGCCCCAGTGGG + Intergenic
1084995960 11:72978578-72978600 TATCGGGGGAGGGTCCCTGTGGG + Intronic
1085249922 11:75136178-75136200 TTTTGTGGGAGGGACCCAGTGGG + Intronic
1085593821 11:77790377-77790399 TGTTGTGGGAGGGACCCTGTGGG - Intronic
1086180281 11:83942920-83942942 TGTTGTGGGAGGGACCCTGTGGG + Intronic
1086186642 11:84025398-84025420 TGTTGGGGGAGGGACCCAGTGGG - Intronic
1086309187 11:85517813-85517835 TGTTGTGGGATGGACCCAGTGGG + Intronic
1086309874 11:85523084-85523106 TATTGGGGGAGGGACCTTGTGGG + Intronic
1086885959 11:92205796-92205818 TGTTGTGGGATGGACCCGGTGGG + Intergenic
1089350289 11:117818192-117818214 GTTTGGGGGGTGGCCTCTGCAGG - Intronic
1090864029 11:130679862-130679884 TGTTGGGGGAGGGACCCAGTGGG - Intronic
1091715931 12:2776183-2776205 TATAGGGGGATGATCCCTGTGGG + Intergenic
1092945777 12:13452783-13452805 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1094265897 12:28559391-28559413 TGTTGTGGGAGGGACCCTGTGGG - Intronic
1094738435 12:33260839-33260861 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
1095106196 12:38235851-38235873 TTTTGTGGGAGGGACCCTGTGGG - Intergenic
1095361846 12:41351687-41351709 TTTTGGAGGAGGGGCCTTGTGGG - Intronic
1095510991 12:42951808-42951830 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1095516732 12:43014706-43014728 TTTTGGGGGAGGGGCCTGGTGGG + Intergenic
1097654556 12:62343951-62343973 TGTTGTGGGATGGGCCTTGTGGG - Intronic
1098371958 12:69768953-69768975 TGTTGTGGGAGGGACCCTGTGGG + Intronic
1099333411 12:81321835-81321857 TTTGGGGGGCAGGCCCATGTAGG + Intronic
1099971861 12:89508697-89508719 TGTTGGGGGAGGGACCTTGTGGG + Intronic
1102275857 12:111581412-111581434 GTTAGGGGGATGGCCGATGTTGG - Intronic
1103763227 12:123265965-123265987 TTCTGGGGGTTGGGCCCTGTTGG - Intronic
1105650675 13:22373403-22373425 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1106159952 13:27192506-27192528 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1107164158 13:37265669-37265691 TGTTGGGGGCGGGGCCCTGTGGG + Intergenic
1108751217 13:53450190-53450212 TGTTGGGGGAGGGACCTTGTGGG - Intergenic
1109303953 13:60618504-60618526 TATAGGGGGAGGGCCCCAGTGGG + Intergenic
1109315559 13:60744978-60745000 TGTTGTGGGAGGGTCCCTGTAGG + Intergenic
1110566372 13:76961113-76961135 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1111756043 13:92397227-92397249 TGTTGTGGGAGGGGCCCTGTGGG + Intronic
1112884916 13:104158499-104158521 TGTTGGGGAAGGGACCCTGTGGG - Intergenic
1113265015 13:108607359-108607381 TGTTGGGGGAGGGACCATGTGGG + Intronic
1115079867 14:29437430-29437452 TTTTGGAGGAGGGACCCAGTGGG + Intergenic
1115878638 14:37890755-37890777 TTTTGTGGGAGGGACCCAGTGGG + Intronic
1115887752 14:37992808-37992830 TCTTGGAGGATGGCCCATGATGG - Intronic
1116075530 14:40105722-40105744 TGTTGGGGGGTGGGGCCTGTTGG + Intergenic
1116126916 14:40800254-40800276 TGTTGTGGGATGGACCCAGTGGG - Intergenic
1116262466 14:42648399-42648421 TGTTGTGGGATGGACCCAGTGGG + Intergenic
1116742786 14:48777375-48777397 TGTTGGGGGATAGACCTTGTGGG + Intergenic
1117782129 14:59244074-59244096 TGTTGGGGGAGGGTCCCAGTGGG + Intronic
1117871967 14:60210635-60210657 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1117996514 14:61483133-61483155 TTTGGAGGGATGGCCACTGATGG - Intronic
1118498443 14:66332458-66332480 TTTTAGGGTATGGCCCCTTCTGG - Intergenic
1119956095 14:78799895-78799917 TATTGGGGGAGGGACCCTGTGGG - Intronic
1121993341 14:98582515-98582537 TTCTGGGGGAAGGAACCTGTGGG - Intergenic
1122398987 14:101456329-101456351 AATTGGGGATTGGCCCCTGTTGG - Intergenic
1122883547 14:104700611-104700633 TTTTGGGGAAAGGCACGTGTTGG + Intronic
1123111384 14:105868570-105868592 TCTGGGGGGATGGCCCTTCTGGG + Intergenic
1127634821 15:60859168-60859190 TTTAGGTGGATGGATCCTGTGGG - Intronic
1127848638 15:62894115-62894137 TTCTGGGGGAAGGCCCTGGTGGG - Intergenic
1128303386 15:66581482-66581504 CTTTGGAGGATGGCCACAGTGGG - Intergenic
1129383235 15:75180981-75181003 TTTAGAGGGATGGTCCCGGTTGG + Intergenic
1130084091 15:80762784-80762806 TTTTGTGGGAGGGACCCAGTGGG - Intergenic
1132011681 15:98281911-98281933 TTTTGTGGGAAGGACCCAGTGGG + Intergenic
1135181427 16:20277883-20277905 TGTTGTGGGAGGGCCCCGGTGGG - Intergenic
1137603420 16:49771538-49771560 TGTTGTGGGAGGGACCCTGTTGG + Intronic
1137961244 16:52884285-52884307 TGTTGTGGGAGGGCCCCGGTGGG - Intergenic
1138507226 16:57484435-57484457 TTTTGGCCGGTGGCCCCTATGGG - Intronic
1140145663 16:72304955-72304977 TATTGTGGGAGGGACCCTGTGGG - Intergenic
1140269043 16:73446511-73446533 TGTTGGGGGAGGGACCTTGTGGG - Intergenic
1141033113 16:80606718-80606740 TGTTGTGGGAGGGACCCTGTGGG + Intronic
1141742551 16:85903640-85903662 CTTTGGGGGCTGGGCCGTGTGGG + Intronic
1142755776 17:2015591-2015613 TTCTGGGGCATCGGCCCTGTTGG - Intronic
1143186709 17:5014360-5014382 TTTTGGGGTATGGCTGCTGAGGG + Intronic
1144300494 17:13919216-13919238 TGTTGGGGGAAGGACCCGGTGGG + Intergenic
1145023296 17:19448700-19448722 TTTTGGGAGATAGGCCCTGGTGG - Intergenic
1146139787 17:30355750-30355772 TGTTGGGGGAGGGGCCCAGTGGG - Intergenic
1146697214 17:34918834-34918856 TTTTGTGGGAGGGACCCAGTGGG + Intergenic
1147536662 17:41326393-41326415 TGCTGGGGGATGACCCCTCTTGG - Intergenic
1147670696 17:42175214-42175236 GTGTGGGGCATGGCCACTGTGGG - Intronic
1148902283 17:50887438-50887460 GATTGGGTGATGGCCCCTATGGG - Intergenic
1149143024 17:53457055-53457077 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
1149175331 17:53863653-53863675 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1149881857 17:60299998-60300020 TATTAGGGGATGGGGCCTGTGGG - Intronic
1150120709 17:62599439-62599461 TTTGGGGGGTTAGCCCGTGTAGG + Intronic
1150531151 17:65983289-65983311 TTTTGTTAGTTGGCCCCTGTAGG - Intronic
1150623162 17:66823421-66823443 TATTGGCGGATGGCCACTGCTGG + Intergenic
1151877500 17:76875258-76875280 TCTTGTGGGATAGACCCTGTGGG + Intronic
1152312033 17:79557388-79557410 GTTTGGAGGGTGGCCCTTGTTGG - Intergenic
1153779052 18:8478372-8478394 TTTTGGGGGCGGGGCCCTCTGGG + Intergenic
1155172500 18:23277200-23277222 TGTTGGGGGAGGGACCCAGTGGG + Intronic
1156117347 18:33802004-33802026 TGTTGTGGGAGGGCCCCAGTGGG - Intergenic
1156290473 18:35745261-35745283 TGTTGGGGGAGGGACCCGGTGGG + Intergenic
1156526412 18:37771833-37771855 TTGTGGCAGATGGCCCCTGGAGG + Intergenic
1156616102 18:38786067-38786089 TTGTGGGGCATTGCCCATGTGGG - Intergenic
1156899063 18:42279255-42279277 TTTGGGGAGATGGGTCCTGTGGG + Intergenic
1158013862 18:52761304-52761326 TGTTGTGGGAGGGACCCTGTGGG - Intronic
1158198370 18:54912951-54912973 TGTTGTGGGAGGGACCCTGTGGG - Intronic
1158298657 18:56027995-56028017 TTTTGTGGGAGGGACCCGGTGGG - Intergenic
1159629224 18:70730228-70730250 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1159687763 18:71444644-71444666 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1159731772 18:72035801-72035823 TGTTGTGGGAGGGCCCCAGTGGG - Intergenic
1159799793 18:72883842-72883864 TATTGTGGGAGGGACCCTGTGGG - Intergenic
1161849921 19:6732920-6732942 ATTTGGGGGATGGCCCGGGTGGG + Intronic
1161867925 19:6848143-6848165 TTTTGGGGCCTGGGCCCTGCGGG + Intronic
1163943570 19:20516192-20516214 TTTTGGGGGAATTCCCCTGATGG + Intergenic
1165012424 19:32858588-32858610 TTTTGGGGGCCGGCCGCTCTTGG - Intronic
1165179468 19:33955363-33955385 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1165248107 19:34509471-34509493 TTTTGTGGGAGGGACCCAGTGGG - Exonic
1165664585 19:37617143-37617165 TGTTGGGGGAGGGACCCTGTGGG + Intronic
1165968580 19:39605473-39605495 TTATGGGAGATGGACCCTGACGG - Intronic
1166252606 19:41581790-41581812 TGTTGGGGGAAGGACCCAGTGGG - Intronic
1166387693 19:42391304-42391326 TTTTGGGGAATGACTCATGTTGG + Intergenic
1168084811 19:54037758-54037780 TGTTGTGGGATGGACCCAGTGGG - Intergenic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
1168343996 19:55641631-55641653 GTTTGGGAGAAGGCCCCTGATGG + Intronic
925794828 2:7530399-7530421 TTTTGAGGGAGGGACCTTGTTGG - Intergenic
926080085 2:9978105-9978127 TGTTGAGGGAGGGACCCTGTGGG - Intronic
927376191 2:22417440-22417462 TGTTGGGGGAAGGACCCTGGGGG - Intergenic
931800707 2:65755506-65755528 TGTTGGGGGAAGGACCCTGTGGG + Intergenic
931941111 2:67253169-67253191 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
933445854 2:82378545-82378567 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
933785407 2:85837010-85837032 TATTGTGGGAGGGACCCTGTGGG - Intergenic
934610439 2:95731589-95731611 TGTTGTGGGATGGACCCAGTGGG - Intergenic
934792731 2:97076098-97076120 TTTTGGGGGATGACTCCTTTGGG - Intergenic
934813885 2:97307585-97307607 TTTTGGGGGATGACTCCTTTGGG + Intergenic
934823810 2:97400897-97400919 TTTTGGGGGATGACTCCTTTGGG - Intergenic
935868708 2:107421024-107421046 TGTTGGGGGAGGGACCTTGTGGG - Intergenic
936689742 2:114872385-114872407 TGTTGGGGGAGGGACCTTGTGGG - Intronic
936787989 2:116118608-116118630 TGTTGGGGGAAGGACCTTGTAGG - Intergenic
937484858 2:122304770-122304792 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
937518350 2:122681437-122681459 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
941137395 2:161734274-161734296 TGTTGTGGGAGGGACCCTGTGGG + Intronic
941417942 2:165245223-165245245 TGTTGTGGGAGGGACCCTGTGGG + Intronic
942869101 2:180713530-180713552 TGTTGTGGGATGGGCCCAGTGGG + Intergenic
943058281 2:183010383-183010405 TTCTGGGGGATGGGCCCAGCTGG - Intronic
943879929 2:193130800-193130822 TTTTGGGGGAGGGACCTAGTGGG - Intergenic
944975799 2:205049449-205049471 TGTTGGGGGAGGTACCCTGTGGG - Intronic
945356408 2:208844250-208844272 TCTTGGGGGAGGGCCCTGGTGGG + Intronic
946631913 2:221678524-221678546 TGTTGGGGGAAGGACCCGGTGGG + Intergenic
946874623 2:224115108-224115130 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
946879534 2:224163209-224163231 TTGTGTGGGATGGACCCAGTGGG + Intergenic
947348556 2:229219472-229219494 TTTTGTGGGAGGGACCCAGTGGG - Intronic
947474293 2:230428834-230428856 TGTTGGGGGAGGGCCCTGGTGGG - Intronic
948356236 2:237379840-237379862 CTTTGGGGGAATTCCCCTGTTGG - Intronic
1168801342 20:645358-645380 TTTTTGGGGAGGGACACTGTAGG + Intergenic
1169628771 20:7601270-7601292 TGTTGGGGGAGGGGCCCAGTGGG + Intergenic
1170018153 20:11806247-11806269 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1170399964 20:15971305-15971327 TGTTGTGGGAGGGACCCTGTAGG + Intronic
1170866805 20:20165015-20165037 TGTTGTGGGAGGGACCCTGTGGG - Intronic
1172937609 20:38631583-38631605 TGTTGTGGGAGGGGCCCTGTGGG - Intronic
1173356392 20:42295770-42295792 TGTTGGGGGAGGGACCTTGTGGG + Intronic
1175754006 20:61517895-61517917 ATTTGGGGGAGGGACCCTGAGGG - Intronic
1177703521 21:24670089-24670111 TGTTGTGGGAGGGACCCTGTAGG - Intergenic
1179001966 21:37469782-37469804 TATTGGAGGAGGGCCCCGGTAGG - Intronic
1179256860 21:39724414-39724436 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1179730764 21:43366030-43366052 CTCTGTGGGATGGCCCCTGGGGG - Intergenic
1181347818 22:22233139-22233161 CTAAGGGGGATGCCCCCTGTAGG - Intergenic
1185124452 22:48999587-48999609 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1185176415 22:49329784-49329806 TCTCTGGGGATGGCTCCTGTTGG + Intergenic
1185372821 22:50468834-50468856 CTCTGGGGGATGCCCACTGTTGG - Intronic
949191936 3:1260652-1260674 TGTTGGGGGAGGGATCCTGTGGG + Intronic
949872694 3:8602791-8602813 TGTTGTGGGATGGACCCAGTGGG + Intergenic
950963488 3:17129526-17129548 TGTTGTGGGATGGACCCAGTGGG + Intergenic
951221454 3:20072769-20072791 TTTTGGGGGTTGGGGCCTGAGGG + Intronic
951778206 3:26333861-26333883 TGTTGTGGGATGGACCCAGTGGG + Intergenic
952458499 3:33499072-33499094 TGTTGGGGGAGGGTCCTTGTGGG + Intronic
954576303 3:51678214-51678236 TTTTGGGGCCTGGTCCCTCTGGG + Intronic
954714837 3:52521817-52521839 TTCTGGGGGCTGGGCCCTGGGGG + Intronic
955367310 3:58322014-58322036 TTTTGAGGGCTGCCACCTGTGGG - Intergenic
955902960 3:63776849-63776871 TGTTGGGGGATGGGGCCTGGTGG + Intergenic
956391755 3:68780430-68780452 TAGTGGGGGAGGGACCCTGTGGG + Intronic
956919244 3:73908965-73908987 TGTTGGGGGAGGGACCCAGTAGG + Intergenic
957336175 3:78831924-78831946 TTTTGTGGGAGGGACCCAGTGGG - Intronic
957494982 3:80981155-80981177 TGTTGGGGGAGGGACCCAGTAGG + Intergenic
957606449 3:82405829-82405851 TGTTGTGGGATGGACCCAGTGGG - Intergenic
957770095 3:84679497-84679519 TGTTGGGGGATGGACCTGGTGGG + Intergenic
958052573 3:88367030-88367052 TATTGTGGGAGGGACCCTGTGGG - Intergenic
959515479 3:107261741-107261763 TGTTGGGGGAGGGACCTTGTGGG - Intergenic
960637932 3:119802117-119802139 TTTCGGGGCATGGCTCCTGGGGG + Intronic
962152213 3:132904736-132904758 TGTTGGGGGAGGGGCCTTGTAGG + Intergenic
964878231 3:161394345-161394367 TGTTGGGGGAGGGACCTTGTGGG - Intergenic
965039529 3:163488746-163488768 TGTTGGGGGAGGGCCACGGTAGG - Intergenic
966218025 3:177522379-177522401 GTTTGGTGGATGGGCCATGTGGG - Intergenic
966341940 3:178934897-178934919 TGTTGGGGGAGGGACCCGGTGGG - Intergenic
967396184 3:189011670-189011692 TGTTGTGGGATGGACCCAGTGGG - Intronic
967839679 3:193995224-193995246 GTGGGAGGGATGGCCCCTGTGGG + Intergenic
968067644 3:195767678-195767700 TTTTGGGGGGTGGCCAGTGATGG - Intronic
968244946 3:197135291-197135313 TGTTGGGGGAGGGACCTTGTAGG + Intronic
969305637 4:6324839-6324861 TTTTGGGGTTTGGCCTCTGCAGG + Intronic
969802105 4:9576767-9576789 TTTTGTGGGAGGGACCCAGTGGG + Intergenic
970801457 4:19977620-19977642 TGTTGTGGGATGGACCCAGTGGG - Intergenic
971048096 4:22828845-22828867 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
971114534 4:23629534-23629556 TGTTGAGGGAGGGCCCCTGGTGG + Intergenic
971224221 4:24736374-24736396 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
972109035 4:35531988-35532010 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
972345272 4:38187767-38187789 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
972977791 4:44658891-44658913 TTTTGTGGGAGGGACCCAGTGGG - Intronic
974195602 4:58570469-58570491 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
974512168 4:62857353-62857375 TGTTGGAGGAGGGCCCTTGTAGG + Intergenic
974724044 4:65776588-65776610 TGTTGTGGGAGGGCCCCAGTGGG + Intergenic
979390270 4:120119133-120119155 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
981378076 4:144039289-144039311 TTTTGGGGGAGGGACCTGGTGGG - Intergenic
982121791 4:152150242-152150264 TATTGGGAGATGGGGCCTGTGGG - Intergenic
982467818 4:155751867-155751889 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
984234132 4:177135786-177135808 TTTTGGGGGATGGCTGATGAGGG + Intergenic
986165160 5:5266663-5266685 ATTTTGGGGATGGCCCCAGTGGG + Intronic
986496382 5:8345759-8345781 TTTTGGGGGAGGGGCCTTGTGGG - Intergenic
986949836 5:13070133-13070155 TGTTGGAGGAGGGCACCTGTGGG - Intergenic
987422559 5:17737654-17737676 TTTTGTGGGAGGGACCCAGTAGG + Intergenic
987586972 5:19867864-19867886 TGTTGTGGGAGGGACCCTGTGGG + Intronic
987842959 5:23244641-23244663 TGTTGGGGGAGGGCCCTGGTGGG - Intergenic
988111453 5:26827493-26827515 TTTTGGGGGAAGGGCCTGGTAGG + Intergenic
988172846 5:27682133-27682155 TGTTGTGGGAAGGACCCTGTGGG - Intergenic
988200071 5:28055852-28055874 TGTTGGGGGAGGGACCCAGTGGG - Intergenic
988662298 5:33285117-33285139 TTTAGGGGAATAGCCTCTGTCGG - Intergenic
988735246 5:34014048-34014070 TTTTGTGGGAGGGACCCAGTGGG - Intronic
991606575 5:68408140-68408162 TGTTGGGGGAGGGGCCTTGTGGG - Intergenic
993251107 5:85524227-85524249 TGTTGGGGGAGGGCCCTGGTGGG + Intergenic
993331359 5:86604465-86604487 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
993416700 5:87642240-87642262 TATTGTGGGATGGACCCTGTGGG + Intergenic
993854489 5:93056507-93056529 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
994211179 5:97088982-97089004 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
995145030 5:108777914-108777936 TGTTGTGGGAGGGACCCTGTGGG - Intronic
995913971 5:117220914-117220936 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
996774879 5:127122333-127122355 TGTTGTGGGAAGGACCCTGTGGG - Intergenic
997812082 5:136980464-136980486 TGTTGTGGGAGGGACCCTGTGGG + Intronic
998576971 5:143327334-143327356 TTTTGGGGGAGGGACCTGGTGGG - Intronic
1000244285 5:159436512-159436534 TGTTGGAGGAGGGGCCCTGTGGG + Intergenic
1001520153 5:172385609-172385631 GTGTGGGGAATGGCCCCTGGAGG + Intronic
1003374539 6:5563559-5563581 TTTTGGGGGATGACTCCTTCTGG + Intronic
1004092990 6:12524406-12524428 TTTTGGGGAATAGCTTCTGTAGG + Intergenic
1004999098 6:21223065-21223087 TTTTCTGGAATGGCCTCTGTAGG + Intronic
1008926848 6:56896262-56896284 TGTTGTGGGATGGACCCAGTGGG + Intronic
1009051811 6:58284190-58284212 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
1009951385 6:70400622-70400644 TTTTGTGGGAGGGACCCAGTGGG - Intergenic
1010085756 6:71916011-71916033 TGTTGTGGGATGGACCCGGTGGG - Intronic
1010530830 6:76965650-76965672 TGTTGGGGGAGGGACCCGGTGGG + Intergenic
1010817557 6:80376319-80376341 TTTTGGGGTATGGGCTGTGTGGG - Intergenic
1013445377 6:110220892-110220914 TATTGTGGGAGGGACCCTGTGGG - Intronic
1013783799 6:113757040-113757062 TATTGTGGGAGGGACCCTGTGGG + Intergenic
1014267033 6:119291098-119291120 TGTTGTGGGATGGACCCGGTGGG + Intronic
1014611548 6:123553822-123553844 TGTTGTGGGAGGGCCCCAGTGGG - Intronic
1014857305 6:126417516-126417538 TGTTGTGGGATGGGCCCAGTGGG + Intergenic
1014999684 6:128199659-128199681 TTGCGGGGGTTGGCCCTTGTGGG - Intronic
1015879403 6:137856214-137856236 TTTTGTGGGAGGGACCCGGTGGG + Intergenic
1016244724 6:141968249-141968271 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1017027483 6:150193943-150193965 TGTTGTGGGAGGGACCCTGTGGG + Intronic
1017388107 6:153908820-153908842 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1017966779 6:159273825-159273847 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1018514421 6:164562814-164562836 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
1018531263 6:164765975-164765997 TTTTGAGAGCTGGCCCCTTTTGG - Intergenic
1019534488 7:1521711-1521733 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1020064942 7:5180944-5180966 TTTTGGGGGATGGGGCTTTTAGG + Intergenic
1020541916 7:9469403-9469425 TGTTGGGGGATGAACCTTGTAGG + Intergenic
1020590781 7:10134014-10134036 TTTTGGAGGAGGGGCCTTGTGGG + Intergenic
1020747753 7:12099313-12099335 TGTTGGGGGATGGACCTGGTGGG + Intergenic
1020891117 7:13878821-13878843 TGTTGTGGGATGGGCCCAGTGGG + Intergenic
1022417191 7:30188621-30188643 TTTTGGGGGAGGGACCTCGTGGG - Intergenic
1024170681 7:46782083-46782105 TGTTGTGGGAAGGACCCTGTGGG + Intergenic
1025170155 7:56749136-56749158 TTTTGTGGGAGGGACCCAGTGGG + Intergenic
1025701730 7:63826582-63826604 TTTTGTGGGAGGGACCCAGTGGG - Intergenic
1026191037 7:68127926-68127948 TGTTGTGGGAAGGACCCTGTGGG - Intergenic
1026445688 7:70482614-70482636 TTTGGGGGGAGGGCCTCTGCAGG + Intronic
1027439518 7:78203934-78203956 TTTGTGGGGATGGCCCCTCTAGG + Intronic
1029960709 7:104687006-104687028 TGTTGGGGGAGGGACCTTGTAGG - Intronic
1029976780 7:104842319-104842341 TTTTGGTGGGTAGCCCATGTAGG - Intronic
1030711270 7:112752732-112752754 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1030723289 7:112894721-112894743 TGTTGTGGGAAGGACCCTGTGGG - Intronic
1031194051 7:118590151-118590173 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
1031808007 7:126330119-126330141 TATTGAGGGAGGGACCCTGTGGG + Intergenic
1032929644 7:136651845-136651867 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1033717620 7:144019054-144019076 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1034040613 7:147873562-147873584 TGTTGTGGGAGGGACCCTGTGGG - Intronic
1034108910 7:148517267-148517289 TGTTGCGGGAGGGACCCTGTGGG + Intergenic
1034749920 7:153559264-153559286 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1034807046 7:154098114-154098136 TGTTGGAGGAGGGACCCTGTGGG + Intronic
1034904672 7:154933744-154933766 TGTTGGGGGAGGGACCCAGTTGG - Intronic
1036588250 8:10144958-10144980 TTTTGGGGGAGGGGGCATGTAGG + Intronic
1037452160 8:19026148-19026170 TTTTGTGGGAGGGACCCAGTAGG - Intronic
1038808857 8:30819562-30819584 TGTTGTGGGATGGACCCAGTGGG - Intergenic
1038942486 8:32320663-32320685 TGTTGGAGGAGGGGCCCTGTGGG - Intronic
1039164276 8:34659518-34659540 TTTTGTGGGAGGGACCCTGTAGG - Intergenic
1039652255 8:39354284-39354306 TTTTGTGGGAGGGACCCAGTGGG + Intergenic
1040323499 8:46329858-46329880 GTTTGGGGGAGGGCCCCCATGGG - Intergenic
1040767958 8:50938537-50938559 TATTGTGGGAGGGACCCTGTGGG + Intergenic
1042635571 8:70869531-70869553 TGTTGTGGGATGGACCCAGTGGG - Intergenic
1042888540 8:73580453-73580475 TCTTGTGGGATGGCACATGTGGG - Intronic
1043738978 8:83784307-83784329 TCTTGTGGGAGGGGCCCTGTGGG + Intergenic
1044395389 8:91704608-91704630 TGTTGTGGGAGGGGCCCTGTGGG - Intergenic
1045716788 8:105056297-105056319 TGTTGTGGGAGGGACCCTGTGGG + Intronic
1045908598 8:107378606-107378628 GTTTGGGGGTTGGGACCTGTTGG + Intronic
1048589884 8:135811506-135811528 TGTTGGGGGAAGGCCCTGGTGGG + Intergenic
1050420163 9:5455576-5455598 TTTTGAAGGATGGCACCTGAAGG + Intronic
1051015978 9:12475745-12475767 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1051285490 9:15492121-15492143 CTTTGGGGGATGGGGACTGTTGG - Intronic
1051975292 9:22941478-22941500 TTTTGTGGGATGGACCCATTGGG - Intergenic
1054453057 9:65413477-65413499 GCCTGGGGGATGGGCCCTGTGGG - Intergenic
1055606380 9:77975098-77975120 CTCTAGGGGATGGGCCCTGTAGG - Intronic
1055735076 9:79319100-79319122 TGTTGTGGGAAGGACCCTGTGGG + Intergenic
1058371849 9:104278141-104278163 TGTTGGGGGAGGGACCTTGTGGG - Intergenic
1059148554 9:111925565-111925587 TGTTGCCGGATGTCCCCTGTGGG + Intronic
1059568029 9:115403073-115403095 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1059633112 9:116145995-116146017 TTTGGAGGGCTGGCCACTGTTGG + Intergenic
1059990232 9:119858375-119858397 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1060448933 9:123718906-123718928 TGTTGTGGGATGGACCCGGTGGG + Intronic
1061617010 9:131787003-131787025 GTTTGGGGCAAGGTCCCTGTGGG - Intergenic
1062304004 9:135891721-135891743 ATTTTGGGGTTGGCCTCTGTTGG - Intronic
1185691385 X:2157892-2157914 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1186284061 X:8025242-8025264 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1186954038 X:14660409-14660431 TTATGGTGGATGGACCATGTAGG + Intronic
1187220097 X:17317151-17317173 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1187480482 X:19650517-19650539 TGTTGGGGGAGGGACCTTGTGGG - Intronic
1187779573 X:22803963-22803985 TGTTGGGGGAGGGGCCTTGTGGG - Intergenic
1188748354 X:33874467-33874489 TTTTGTGGGAGGGACCCAGTGGG - Intergenic
1188927356 X:36061033-36061055 TATTGGAGGAGGGGCCCTGTGGG + Intronic
1189036110 X:37494853-37494875 TTTTGTGGGAGGGACCCAGTGGG - Intronic
1189064479 X:37792440-37792462 TTATGGGCTATGGCTCCTGTAGG - Intronic
1189537830 X:41954928-41954950 TGTTGTGGGAGGGACCCTGTGGG - Intergenic
1191669798 X:63738607-63738629 TTTTGAGGGATGTCTTCTGTGGG - Intronic
1193250089 X:79280986-79281008 TTTTGTGGGAGGGACCCAGTGGG - Intergenic
1193489597 X:82133273-82133295 TTTTGGAGGATGGGCCTGGTGGG - Intergenic
1193549773 X:82877589-82877611 TTTTGGAGGAGGGGCCTTGTGGG + Intergenic
1193603518 X:83538158-83538180 TTTTTGAGGATGGCCCATTTTGG - Intergenic
1196389645 X:115193824-115193846 TTTTGGGGGTTTGCACCTTTGGG - Intronic
1196460553 X:115924823-115924845 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
1197128251 X:122972905-122972927 TGTTGTGGGAGGGACCCTGTGGG + Intergenic
1197382141 X:125758198-125758220 TTTTGGGGCATGAACCCGGTGGG + Intergenic
1197595230 X:128456102-128456124 TTTTGGGGGAGGGACCTGGTGGG - Intergenic
1197676395 X:129335125-129335147 TGTTGGGGGAGGGACGCTGTGGG + Intergenic
1198271510 X:135060131-135060153 TGTTGGGGGAGGGACCTTGTGGG + Intergenic
1198803823 X:140474326-140474348 TGTTGAGGGAGGGACCCTGTGGG + Intergenic
1198818938 X:140624697-140624719 TGTTGGGGGAGGGACCTTGTGGG - Intergenic
1199021240 X:142881008-142881030 TTTTGGGGGAAGACCCCTATAGG + Intergenic
1201504368 Y:14681430-14681452 TGTTGGGGGAGGGTCCCTGTGGG - Intronic
1201959252 Y:19660656-19660678 TTTTGTGGGAGGGCCCAAGTGGG - Intergenic