ID: 901772592

View in Genome Browser
Species Human (GRCh38)
Location 1:11537903-11537925
Sequence TGGAATGAATCCCTGAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 1, 2: 4, 3: 64, 4: 394}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901772582_901772592 30 Left 901772582 1:11537850-11537872 CCCTGGAGACAGACATTGCCACC 0: 1
1: 0
2: 2
3: 18
4: 188
Right 901772592 1:11537903-11537925 TGGAATGAATCCCTGAGGGTGGG 0: 1
1: 1
2: 4
3: 64
4: 394
901772587_901772592 9 Left 901772587 1:11537871-11537893 CCAGGCTTCATGAGTGTGGACTC 0: 1
1: 0
2: 1
3: 12
4: 112
Right 901772592 1:11537903-11537925 TGGAATGAATCCCTGAGGGTGGG 0: 1
1: 1
2: 4
3: 64
4: 394
901772583_901772592 29 Left 901772583 1:11537851-11537873 CCTGGAGACAGACATTGCCACCA 0: 1
1: 0
2: 2
3: 33
4: 290
Right 901772592 1:11537903-11537925 TGGAATGAATCCCTGAGGGTGGG 0: 1
1: 1
2: 4
3: 64
4: 394
901772586_901772592 12 Left 901772586 1:11537868-11537890 CCACCAGGCTTCATGAGTGTGGA 0: 1
1: 0
2: 1
3: 12
4: 112
Right 901772592 1:11537903-11537925 TGGAATGAATCCCTGAGGGTGGG 0: 1
1: 1
2: 4
3: 64
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901772592 Original CRISPR TGGAATGAATCCCTGAGGGT GGG Intergenic
900015413 1:145591-145613 TGGACTTAATCCCTGAGGCAAGG - Intergenic
900045678 1:504185-504207 TGGACTTAATCCCTGAGGCAAGG - Intergenic
900067878 1:745900-745922 TGGACTTAATCCCTGAGGCAAGG - Intergenic
900240982 1:1617096-1617118 TGGGATGAAGCCCTGAGGCGGGG - Intronic
901502180 1:9659477-9659499 TGAAAAAAATGCCTGAGGGTGGG - Intronic
901571644 1:10165742-10165764 GGGAAGGTATCCCTGAGGGAGGG - Intronic
901709817 1:11105121-11105143 GAGAATGCATCCCTGAGGGTAGG + Intergenic
901772592 1:11537903-11537925 TGGAATGAATCCCTGAGGGTGGG + Intergenic
902059826 1:13632674-13632696 GAGAATGTGTCCCTGAGGGTAGG - Intergenic
902905093 1:19550630-19550652 AGGAATGCATTCCTGGGGGTAGG - Intergenic
902964552 1:19990163-19990185 GAGAATGCATCCCTGAGGGTAGG + Intergenic
906410734 1:45576920-45576942 GAGAATGCGTCCCTGAGGGTAGG + Intergenic
906479118 1:46188870-46188892 TGGAATGCTGCCCTGAGGGTGGG - Exonic
906577138 1:46901232-46901254 AGGAATGCATTCCTGGGGGTAGG + Intergenic
906577911 1:46907544-46907566 AGGAATGCATTCCTGGGGGTAGG + Intergenic
906669469 1:47644029-47644051 TGCAATGAATTCCAGATGGTGGG + Intergenic
906747846 1:48234113-48234135 TGGAATGTCTCCCAGAGGGAAGG + Intronic
907533557 1:55126808-55126830 TTGAAGGAATTCCTGAGGGGAGG - Intronic
907622576 1:55996332-55996354 GAGAATGCATCCCTGAGGGGAGG - Intergenic
908045308 1:60162053-60162075 GAGAATGCACCCCTGAGGGTGGG - Intergenic
908225716 1:62053962-62053984 TGGAATGAGTCCATGAGGGAAGG - Intronic
909136329 1:71804979-71805001 GAGAATGCATCCCTGAGGGTAGG + Intronic
909464784 1:75961147-75961169 GAGAATGCCTCCCTGAGGGTAGG + Intergenic
909556577 1:76960664-76960686 GAGAATGCATCCCTGAGGGTAGG - Intronic
909625061 1:77706158-77706180 TGGAATGAATACCTAAGAGTGGG + Intronic
909812913 1:79953729-79953751 GCGAATGAGTCCCTGAGGGTAGG - Intergenic
910373402 1:86542887-86542909 TGGAATGTCTACCTGAGGTTGGG + Intergenic
910898325 1:92092059-92092081 TGAAATGAGTTCATGAGGGTGGG + Intronic
911893664 1:103403086-103403108 GAGAATGCATCCCTGAGGGTGGG + Intergenic
912112370 1:106358739-106358761 AGGAATGCATTCCTGGGGGTAGG - Intergenic
912664571 1:111567600-111567622 TTAAATGAAGTCCTGAGGGTAGG + Intronic
913024569 1:114824248-114824270 GAGAATGCATCCCTGAGGGTAGG + Intergenic
915448384 1:155988115-155988137 GAGAATGCACCCCTGAGGGTGGG + Intronic
915611139 1:156993961-156993983 TGAATTGGATCCCTAAGGGTGGG - Intronic
916122043 1:161537244-161537266 AGGAATGCATTCCTGGGGGTAGG + Intergenic
916131932 1:161618669-161618691 AGGAATGCATTCCTGGGGGTAGG + Intronic
916626934 1:166568040-166568062 GAGAATGTGTCCCTGAGGGTAGG - Intergenic
917164644 1:172098260-172098282 GAGAATGCGTCCCTGAGGGTAGG - Intronic
917288968 1:173452523-173452545 TAGAATGAACTCTTGAGGGTTGG - Intergenic
917293134 1:173492228-173492250 TGGAATCAATCCCTGAGGGTAGG - Intergenic
919190010 1:194204045-194204067 GAGAATGCATCCCTGAGGGTAGG - Intergenic
919493882 1:198239774-198239796 CAGAATGAATCCCTGATGTTAGG - Intronic
919924327 1:202184697-202184719 GGCAATGAATTCCTGTGGGTGGG - Intergenic
920179289 1:204122582-204122604 TGGCCTGAATCCCTGATGCTTGG - Intronic
920599076 1:207303990-207304012 GAGAATGCGTCCCTGAGGGTAGG - Intergenic
920909013 1:210196602-210196624 AGGAATGCATTCCTGGGGGTAGG - Intergenic
921275352 1:213513583-213513605 TGCAATCAATCCCTGAGAATGGG - Intergenic
922103242 1:222491279-222491301 TGGACTTAATCCCTGAGGCAAGG - Intergenic
922263563 1:223963791-223963813 TGGACTTAATCCCTGAGGCAAGG - Intergenic
922376206 1:224970139-224970161 GAGAATGCGTCCCTGAGGGTAGG + Intronic
922694594 1:227722786-227722808 GAGAATGAATCCCTGAGGGTAGG + Intergenic
924345406 1:243068786-243068808 TGGACTTAATCCCTGAGGCAAGG - Intergenic
1063862692 10:10328732-10328754 AGGAATGATTCCCTGAGAATTGG - Intergenic
1064017156 10:11781513-11781535 TGGAGACAATCCCTGAGGGGTGG + Intergenic
1064796226 10:19014680-19014702 TGGAATGTATCCCTCATGGATGG + Intergenic
1066658578 10:37718234-37718256 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1066730932 10:38436026-38436048 TGGACTTAATCCCTGAGGCAAGG + Intergenic
1067995497 10:51268447-51268469 GAGAATGCATCCCTGAGGGTAGG - Intronic
1068086235 10:52376285-52376307 TGTGATGTATCCCTGAGGCTGGG - Intergenic
1068290865 10:55000264-55000286 GAGAATGTGTCCCTGAGGGTAGG - Intronic
1068662606 10:59637867-59637889 GAGAATGCGTCCCTGAGGGTGGG - Intergenic
1069103987 10:64360300-64360322 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1069557193 10:69406272-69406294 TGGCAGGAAACCCTGAAGGTGGG - Intronic
1070337857 10:75470881-75470903 TGGAATGAATCCTTCAGGTATGG - Intronic
1071192685 10:83120610-83120632 TGCTATGAATACCTGAGGTTGGG - Intergenic
1071428659 10:85584944-85584966 AGGAATGAATCTCTGAGCTTGGG + Intergenic
1072459302 10:95604790-95604812 TGGAATGCAGTCCTGATGGTTGG + Intergenic
1072883984 10:99257405-99257427 GAGAATGCATCCCTGAGGGTAGG + Intergenic
1075178497 10:120187882-120187904 TGGAATTAATGTCTGAGTGTTGG - Intergenic
1076604044 10:131677939-131677961 TCTAATGACTCCCTGAGGCTGGG + Intergenic
1076972004 11:140659-140681 TGGACTTAATCCCTGAGGCAAGG - Intergenic
1077976944 11:7256654-7256676 TGGATTTAATCCCTAAGTGTAGG + Intronic
1078055980 11:8009293-8009315 TGGGATGACACCCTGTGGGTTGG - Intergenic
1078804558 11:14684709-14684731 AGGAATGCATCCCTGGGGGGAGG - Intronic
1079443546 11:20538923-20538945 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1080603680 11:33845654-33845676 TAGAAAGTGTCCCTGAGGGTGGG + Intergenic
1080878616 11:36298943-36298965 TAAAATGAACCCCTTAGGGTAGG - Intronic
1081634772 11:44713792-44713814 GGGAATGAATCCCTTGGGCTAGG - Intergenic
1082047878 11:47745364-47745386 AGGAATGCATTCCTGGGGGTAGG + Intronic
1082662109 11:55924444-55924466 GAGAATGCCTCCCTGAGGGTAGG - Intergenic
1083550064 11:63581362-63581384 AGGAATGCATTCCTGGGGGTAGG + Intronic
1087120034 11:94564156-94564178 TGGAATGAATCTCTGAGGTGGGG - Intronic
1088653734 11:111979427-111979449 TGGAAAGAATTCCTGAGAGGGGG + Intronic
1088967275 11:114736366-114736388 GAGAATGAACCCCTGAGGGTGGG - Intergenic
1089654129 11:119934795-119934817 TGGAATGAATGAATGAGGGAGGG + Intergenic
1089858633 11:121569473-121569495 GAGAATGCGTCCCTGAGGGTAGG + Intronic
1090173511 11:124626144-124626166 TGGAATGCAACCCAGAGAGTTGG - Intronic
1091581435 12:1792746-1792768 TGGAGTGAAATCCTTAGGGTTGG - Exonic
1093074754 12:14746176-14746198 GAGAATGCACCCCTGAGGGTCGG - Intergenic
1094039326 12:26106484-26106506 TGCAATCAATCCCTGAAGGCAGG + Intergenic
1094467249 12:30766517-30766539 TGGGATGAATACCTGGAGGTGGG - Intergenic
1095363501 12:41373431-41373453 GAGAATGCATCCCTGAGGGTAGG - Intronic
1095495948 12:42783774-42783796 TTGAATAAATCCCTGAGTTTTGG + Intergenic
1096653691 12:53075262-53075284 TGGGATGAATTGCTGGGGGTGGG + Intronic
1098747234 12:74254068-74254090 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1098960543 12:76735678-76735700 GAGAATGCGTCCCTGAGGGTAGG + Intergenic
1100364957 12:93911607-93911629 TGGGAAGAATCACAGAGGGTTGG - Intergenic
1100499089 12:95156319-95156341 GAGAATGCATCCCTGAGGGTGGG + Intronic
1100513408 12:95300467-95300489 TGTAATGAGTCCCTGGGAGTTGG - Exonic
1101526755 12:105538150-105538172 TGGAATGGATGGCTGAGGATAGG + Intergenic
1101947404 12:109148163-109148185 TGGAAACAGTCCCTGAGGTTTGG + Intronic
1104644704 12:130488706-130488728 TGGAATGGAGCCCTCAGGATGGG - Intronic
1104693162 12:130841705-130841727 GAGAAAGCATCCCTGAGGGTAGG + Intergenic
1105227679 13:18451532-18451554 GAGAATGCACCCCTGAGGGTGGG - Intergenic
1105829789 13:24153832-24153854 TGGAATTCATCCCTTGGGGTTGG + Intronic
1106360617 13:29027496-29027518 TGCAGTAATTCCCTGAGGGTTGG + Intronic
1108294624 13:49001589-49001611 GAGAATGCATCCCTGAGGGTAGG + Intronic
1109260725 13:60142668-60142690 GGGAAAGAGTCCCTGATGGTAGG - Intronic
1109424353 13:62151720-62151742 GAGAATGTGTCCCTGAGGGTAGG + Intergenic
1111609350 13:90583325-90583347 TTGGATGAAGTCCTGAGGGTGGG + Intergenic
1111958388 13:94782733-94782755 AGGATTGAATCCATGGGGGTGGG + Intergenic
1112850628 13:103701804-103701826 TGGAATGAATCCCTAATGGATGG - Intergenic
1113442473 13:110340003-110340025 TGGCTTGAATCCTTGAGGGTGGG + Intronic
1114012114 14:18379994-18380016 GAGAATGCACCCCTGAGGGTGGG - Intergenic
1114271369 14:21102357-21102379 TGGAATGACTCCCCTAGGCTGGG + Intronic
1114539936 14:23447564-23447586 TGGAATGAATTCCTGGGGTGTGG - Intergenic
1114753085 14:25227720-25227742 GAGAATGTATCCCTGAGGGTAGG - Intergenic
1115746536 14:36443746-36443768 TTGAATGAATGCCTGGGGGTTGG - Intergenic
1116301804 14:43192547-43192569 GAGAATGCGTCCCTGAGGGTAGG - Intergenic
1118372211 14:65146878-65146900 GAGAATGCGTCCCTGAGGGTAGG - Intergenic
1118416588 14:65543641-65543663 CAGAATTTATCCCTGAGGGTAGG - Intronic
1119401899 14:74368374-74368396 TGGAAGGAATACCTGAGCCTGGG + Intergenic
1119437509 14:74607089-74607111 TGGGATGAGCCACTGAGGGTAGG + Intronic
1119959857 14:78842748-78842770 GAGAATGCATCCCTGAGGGTAGG - Intronic
1120667534 14:87324527-87324549 TGTAATGAGACCATGAGGGTCGG - Intergenic
1122094750 14:99362770-99362792 TGGAATGAATTCCTGAGCCTCGG - Intergenic
1122739882 14:103866163-103866185 TGGAATGAGGCCCTTGGGGTGGG + Intergenic
1123664259 15:22595693-22595715 GAGAATGTATCCCTGAGGGGAGG + Intergenic
1123708198 15:22966001-22966023 TAAAATGAATCCATCAGGGTGGG + Intronic
1123839198 15:24229402-24229424 GAGAATGCATCCCTGAGAGTAGG - Intergenic
1124318092 15:28690129-28690151 GAGAATGTATCCCTGAGGGGAGG + Intergenic
1124429370 15:29593036-29593058 TGTAATGAATATCTGAGGCTGGG - Intergenic
1125567337 15:40686602-40686624 GAGAATGCATCCCTGAGGGTAGG - Intergenic
1125822164 15:42641221-42641243 TGGAGTGAATCCTTGAAGGGAGG + Intronic
1127024662 15:54790754-54790776 TGGAATGAATTCCCAAGAGTGGG - Intergenic
1127067095 15:55251995-55252017 TGTACTTAATCCCTGTGGGTTGG - Intronic
1127676380 15:61243093-61243115 GAGAATGCATCCCTGAGGGTAGG - Intergenic
1127704056 15:61529843-61529865 TAGAATGAGGCCCTTAGGGTGGG - Intergenic
1127755126 15:62084599-62084621 GGGAATGTGTCCCTGAGGGTAGG - Intergenic
1128904589 15:71455568-71455590 AGGAATGAATCCCTAATGCTGGG - Intronic
1129201749 15:74006656-74006678 TAGAAGGAATACCTGAGGCTGGG + Intronic
1130757312 15:86778496-86778518 GAGAATGCGTCCCTGAGGGTAGG - Intronic
1132011725 15:98282253-98282275 TGGAGTGCCTCCCTGAAGGTGGG - Intergenic
1132213693 15:100047043-100047065 GAGAATGAGCCCCTGAGGGTAGG + Intronic
1132295038 15:100728594-100728616 TGGAATGGAGCTCTGAGGCTGGG + Intergenic
1135093670 16:19543688-19543710 AGGAATGCATCCCTGGGGGGAGG + Intronic
1135131725 16:19859149-19859171 TGGAATGTATAAATGAGGGTGGG - Exonic
1135202821 16:20453760-20453782 AGGAATGCATTCCTGGGGGTAGG + Intronic
1135206019 16:20484581-20484603 TGGAATCAACCCCTGGGGGAAGG + Intronic
1135212893 16:20539203-20539225 TGGAATCAACCCCTGGGGGAAGG - Intronic
1135216276 16:20574106-20574128 AGGAATGCATTCCTGGGGGTAGG - Intronic
1135885632 16:26304083-26304105 GGGAATGAATCCTTGAGTATTGG - Intergenic
1136642621 16:31579483-31579505 GAGAATGTGTCCCTGAGGGTAGG - Intergenic
1136662131 16:31772134-31772156 GGGACTGAACCCCTGAGGGGAGG + Intronic
1138767540 16:59622466-59622488 GAGAATGCGTCCCTGAGGGTAGG - Intergenic
1138875286 16:60941691-60941713 GAGAGTGCATCCCTGAGGGTAGG + Intergenic
1139000889 16:62508441-62508463 GAGAATGCGTCCCTGAGGGTGGG - Intergenic
1139006118 16:62573388-62573410 TGGAATGATTGCCTGAGGTACGG + Intergenic
1139901591 16:70332695-70332717 ATGAATGAGTCCCTGAGAGTTGG - Intronic
1139916092 16:70429296-70429318 AAGAATGAATCCCTGAGGCCGGG + Intronic
1141745199 16:85920869-85920891 GGGAATGAATCTCTAATGGTGGG + Intronic
1142448242 16:90156864-90156886 TGGACTTAATCCCTGAGGCAAGG + Intergenic
1142459242 17:78461-78483 TGGACTTAATCCCTGAGGCAAGG - Intergenic
1144685173 17:17221443-17221465 TGGCAGGAATCGCTGAGGGAGGG - Intronic
1145213594 17:21034974-21034996 TGGAATGTATCCCTCAAGGATGG + Intronic
1147437912 17:40429120-40429142 GGGAATTAATCCCTAATGGTAGG + Intergenic
1147840215 17:43366136-43366158 GAGAATGCGTCCCTGAGGGTAGG - Intergenic
1148123278 17:45224511-45224533 TGGACTACATCCCTGAGGGCAGG - Intronic
1149174985 17:53858878-53858900 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1149290538 17:55213962-55213984 TGGAATGTATCCAAAAGGGTAGG + Intergenic
1150447342 17:65237280-65237302 GAGAATGCGTCCCTGAGGGTGGG + Intergenic
1150769925 17:68032278-68032300 TGAGATGAATTCATGAGGGTGGG + Intergenic
1151443282 17:74147558-74147580 TGGCATAGAGCCCTGAGGGTGGG + Intergenic
1152438537 17:80290748-80290770 TGGGAGGAATCCCTCAGGGAAGG + Intronic
1153138383 18:1943333-1943355 TGTAAAGAATACCTGAGGCTGGG - Intergenic
1154525703 18:15287944-15287966 GAGAATGCACCCCTGAGGGTGGG + Intergenic
1155854493 18:30816002-30816024 GAGAATGCGTCCCTGAGGGTAGG + Intergenic
1156126027 18:33905939-33905961 TGGAATGAACCTTTGAGAGTGGG + Intronic
1156761475 18:40596539-40596561 CAGAATGCACCCCTGAGGGTGGG - Intergenic
1157558584 18:48630276-48630298 TGGAATGGATCCCTCAGGGTTGG + Intronic
1157643759 18:49245442-49245464 AGGAATGCATTCCTGGGGGTAGG + Intronic
1157673900 18:49553796-49553818 GAGAATGCGTCCCTGAGGGTCGG - Intergenic
1157738558 18:50072317-50072339 TGGACTGGATCCCTGAAGCTTGG - Intronic
1157758643 18:50242005-50242027 AGGAATGCATTCCTGGGGGTAGG - Intronic
1158416709 18:57255167-57255189 AGGAAAGAATCCCTGTTGGTGGG + Intergenic
1159347707 18:67228213-67228235 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1159686178 18:71423795-71423817 GAGAATGCATCCCTGAAGGTAGG + Intergenic
1159850186 18:73517509-73517531 GAGAATGCGTCCCTGAGGGTAGG - Intergenic
1160238849 18:77107887-77107909 TTATATGAATCACTGAGGGTTGG + Intronic
1160439435 18:78878036-78878058 TCGCATGAATCCCTGATGATGGG - Intergenic
1160648962 19:210967-210989 TGGACTTAATCCCTGAGGCAAGG - Intergenic
1161556312 19:4944630-4944652 TGCAATGAATCCTTGGGGGTGGG + Intronic
1161592986 19:5137079-5137101 TGGATTGAAGCTCAGAGGGTGGG + Intronic
1162606752 19:11714788-11714810 TGAAATGAGACCATGAGGGTAGG - Intergenic
1162684135 19:12367622-12367644 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1163959704 19:20677580-20677602 GAGAATGCATCCCTGAGGGTAGG + Intronic
1164339301 19:24371905-24371927 GAGAATGCTTCCCTGAGGGTAGG + Intergenic
1164340226 19:24387202-24387224 GATAATGCATCCCTGAGGGTAGG - Intergenic
1165071365 19:33256622-33256644 TGGAAAGAAGCCCTGAGGGCAGG + Intergenic
1165138203 19:33684119-33684141 TGGAATGTGTCCGTGATGGTGGG + Intronic
1165685400 19:37815709-37815731 AGGAATGCATTCCTGGGGGTAGG + Intronic
1166151122 19:40876591-40876613 GGGATTGAAGTCCTGAGGGTTGG + Exonic
925212080 2:2057944-2057966 TGGGATTAATGCCTGAGAGTGGG + Intronic
925350112 2:3195148-3195170 TGTCATGAATCCCAGAGGGCAGG + Intronic
925660611 2:6198507-6198529 AGGAATGCATTCCTGTGGGTAGG + Intergenic
927395713 2:22648791-22648813 TAGAATGAATGTATGAGGGTAGG + Intergenic
929368571 2:41192654-41192676 TGGAATCAATCCCTGTGGCGAGG + Intergenic
930306049 2:49675856-49675878 GGGAAGGAATTCCTAAGGGTGGG + Intergenic
930489506 2:52050754-52050776 GAGAATGCACCCCTGAGGGTAGG + Intergenic
931562196 2:63573835-63573857 GAGAATGCGTCCCTGAGGGTAGG + Intronic
933106181 2:78328336-78328358 TGGAATGAATAAGTGAGAGTTGG + Intergenic
933401920 2:81809274-81809296 AGGAATGTATTCCTGGGGGTAGG - Intergenic
933611878 2:84444774-84444796 GAGAATGCATCCCTGAGGGTAGG - Intronic
934624685 2:95836237-95836259 TGGAAGGACTCCCACAGGGTGGG + Intergenic
935419965 2:102856822-102856844 TGGACTGAATCCCAGAGTATAGG + Intergenic
936874196 2:117168342-117168364 GAGAATGCATCCCTGAAGGTAGG - Intergenic
936927685 2:117754492-117754514 TTGAATGAATCAGTCAGGGTAGG - Intergenic
937591538 2:123618866-123618888 AGGAATGCATTCCTGGGGGTAGG - Intergenic
938308747 2:130271242-130271264 GAGAATGCATCCCTGAGGGTAGG - Intergenic
938524801 2:132119305-132119327 GAGAATGCACCCCTGAGGGTGGG + Intergenic
938634330 2:133206815-133206837 AGGAATGCATTCCTGGGGGTAGG + Intronic
938960492 2:136336253-136336275 TTGAGTGAAGCCCTGAGGGCTGG + Intergenic
940156528 2:150662412-150662434 AAGAATGCATCCCTGAGGGGAGG - Intergenic
941202290 2:162526512-162526534 CAGAATGCATCCCTGAGTGTAGG - Intronic
942478316 2:176353233-176353255 GAGAACGCATCCCTGAGGGTAGG - Intergenic
942485747 2:176438267-176438289 TGGAGTGAGTCCCTGATGCTGGG + Intergenic
944397079 2:199280563-199280585 GAGAATGTGTCCCTGAGGGTAGG + Intronic
945220688 2:207480792-207480814 GAGAAAGAATCCCTGAGGGTTGG - Intergenic
945386118 2:209203024-209203046 GAGAATGCGTCCCTGAGGGTAGG - Intergenic
945456577 2:210058156-210058178 GAGAATGCGTCCCTGAGGGTAGG + Intronic
945897199 2:215497250-215497272 GAGAATGCATCCCTGAGGGTGGG + Intergenic
945959835 2:216121593-216121615 GGTAATGAAGTCCTGAGGGTGGG - Intronic
946125789 2:217561539-217561561 AGGAATGCATTCCTGGGGGTAGG + Intronic
1169067778 20:2704180-2704202 GGGCATGAATCCCAGGGGGTGGG + Intronic
1169613776 20:7414567-7414589 GAGAATGCGTCCCTGAGGGTAGG - Intergenic
1171232256 20:23496762-23496784 GAGAATGCATCCCTGAGGGTAGG - Intergenic
1171232308 20:23497317-23497339 AGGAATGAATCCCTTTGGCTTGG + Intergenic
1171492478 20:25531070-25531092 GAGAATGCGTCCCTGAGGGTGGG - Intronic
1171978045 20:31607757-31607779 TGGCAGCAATCCTTGAGGGTTGG - Intergenic
1174763732 20:53231845-53231867 TGCAGTGAATCCTTGAGAGTTGG + Intronic
1175761496 20:61564805-61564827 TTGTTTGAATCCCTGAGGGAGGG - Intronic
1176333977 21:5578374-5578396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176393780 21:6242578-6242600 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1176458204 21:6931148-6931170 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1176467639 21:7073596-7073618 TGTAATTAAACCCTTAGGGTGGG + Intronic
1176491200 21:7455374-7455396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176509442 21:7683009-7683031 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1176771721 21:13080543-13080565 GAGAATGCACCCCTGAGGGTGGG - Intergenic
1176836378 21:13796243-13796265 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1177649868 21:23946564-23946586 ATGAATGAATACCTGAGGCTGGG + Intergenic
1178014590 21:28329231-28329253 GAGAATGTACCCCTGAGGGTAGG - Intergenic
1178485166 21:33014599-33014621 TGGAATGCATACATGATGGTGGG + Intergenic
1179003158 21:37482789-37482811 GAGAATGAGCCCCTGAGGGTAGG - Intronic
1179443118 21:41409850-41409872 TTAAATGAAGCCCTAAGGGTGGG - Intergenic
1180436605 22:15310802-15310824 GAGAATGCACCCCTGAGGGTGGG - Intergenic
1180518849 22:16174990-16175012 GAGAATGCACCCCTGAGGGTGGG - Intergenic
1182486065 22:30639604-30639626 GAGAATGCGTCCCTGAGGGTAGG - Intronic
1182820665 22:33213100-33213122 TCAAATTCATCCCTGAGGGTTGG - Intronic
1183171363 22:36190531-36190553 GAGAATGCACCCCTGAGGGTGGG - Exonic
1184062920 22:42095689-42095711 GAGAATGCGTCCCTGAGGGTAGG + Intergenic
1185127582 22:49020080-49020102 TGGAAGCAAACCCTGAGGTTAGG + Intergenic
951399601 3:22215408-22215430 GAGAATGCATCCCTGAAGGTAGG + Intronic
953230762 3:41062972-41062994 AAGAAGGAATCCCTGTGGGTGGG + Intergenic
954272362 3:49519646-49519668 TGGAAGGCATCCTTGGGGGTGGG + Intronic
954400071 3:50314882-50314904 TGGCATGAATCCTTGAGGAGGGG - Intergenic
954738654 3:52728802-52728824 AGGAATGCATCCCTGGGGGGAGG + Intronic
956032311 3:65051842-65051864 TGAAATGAATACCTGAGGTCTGG + Intergenic
956131353 3:66056577-66056599 GAGAATGCGTCCCTGAGGGTGGG - Intergenic
956235023 3:67060208-67060230 GAGAATGCATCCCTGAGGGTAGG + Intergenic
956246925 3:67194019-67194041 TGGAATGAATCCCAGAGAAAGGG + Intergenic
957090721 3:75727498-75727520 AGGAATGCATTCCTGGGGGTAGG + Intronic
957926619 3:86822191-86822213 GAGAATGTGTCCCTGAGGGTAGG - Intergenic
958603359 3:96327653-96327675 GAGAATGCGTCCCTGAGGGTAGG + Intergenic
958625282 3:96614993-96615015 GAGAATGCATCCCTGAGGGGAGG - Intergenic
958659623 3:97049620-97049642 AGGAATGAATACCTGAGACTGGG + Intronic
958761267 3:98311153-98311175 GAGAATGCATCCCTGAGGGGAGG - Intergenic
958958274 3:100485252-100485274 TGGAATGACTCCTTGAAGCTTGG + Intergenic
959126348 3:102294462-102294484 AGGAATGCCTCCCTGAGGTTGGG + Intronic
959729412 3:109583877-109583899 AGGAATGCATTCCTGGGGGTAGG + Intergenic
960112856 3:113862334-113862356 GAGAATGTGTCCCTGAGGGTAGG - Intronic
960374268 3:116878957-116878979 GAGAATGCACCCCTGAGGGTAGG - Intronic
960541261 3:118865064-118865086 GAGAATGCGTCCCTGAGGGTAGG + Intergenic
961583411 3:127902231-127902253 TGAAATGAGGCCATGAGGGTGGG - Intergenic
962436905 3:135375233-135375255 TTGAAAGAAGCCCTGAAGGTGGG - Intergenic
962651538 3:137498850-137498872 GAGAATGCATCCCTGAGGGTAGG + Intergenic
962764127 3:138545715-138545737 AGGAATGCATTCCTGAGGGGAGG + Intronic
963176594 3:142304151-142304173 GAGAATGCACCCCTGAGGGTGGG - Intergenic
963414982 3:144983636-144983658 GAGAATGCACCCCTGAGGGTGGG - Intergenic
963861873 3:150320062-150320084 TGGAATGACTCACTGGGGCTTGG - Intergenic
964196213 3:154067875-154067897 GAGAATGCGTCCCTGAGGGTGGG + Intergenic
964613003 3:158633657-158633679 AGGAATGCATTCCTGGGGGTAGG - Intergenic
964880426 3:161417353-161417375 ATGCATGCATCCCTGAGGGTAGG - Intergenic
964945863 3:162222858-162222880 GAGAATGCATCCCTGAGGGTAGG + Intergenic
965400747 3:168209633-168209655 GAGAATGCATCCCTGAGGGTAGG - Intergenic
967984432 3:195084746-195084768 ATGAATGAATCCCTGGGGTTGGG - Intronic
968192919 3:196683589-196683611 GAGAATGCACCCCTGAGGGTGGG - Intronic
968212181 3:196858023-196858045 GAGAATGCACCCCTGAGGGTGGG - Intergenic
968368887 3:198209160-198209182 TGGACTTAATCCCTGAGGCAAGG + Intergenic
970056986 4:11985133-11985155 TGCACTGAATCCTTGAAGGTGGG + Intergenic
971365808 4:25976331-25976353 CAGAATGCGTCCCTGAGGGTAGG + Intergenic
973585872 4:52390570-52390592 GAGAATGCATCCCTGATGGTAGG + Intergenic
974214757 4:58830053-58830075 GAGAATGCATCCCTGAGGGTAGG - Intergenic
974548675 4:63345483-63345505 GAGAATGCACCCCTGAGGGTGGG + Intergenic
974983304 4:68989163-68989185 GAGAATGCATTCCTGAGGGTAGG + Intergenic
976257966 4:83118525-83118547 TGGTAAGATTCCCTGTGGGTTGG + Intronic
976589430 4:86834377-86834399 ATGAAGGAATACCTGAGGGTAGG - Intronic
976994063 4:91407784-91407806 TGGAATGGATCCCTCATGGGTGG - Intronic
977927653 4:102719193-102719215 AGGAATGCATTCCTGGGGGTAGG - Intronic
978023916 4:103848587-103848609 GAGAATGCACCCCTGAGGGTGGG - Intergenic
979257311 4:118618892-118618914 TGGACTTAATCCCTGAGGCAAGG + Intergenic
979331040 4:119421656-119421678 TGGACTTAATCCCTGAGGCAAGG - Intergenic
981421161 4:144551627-144551649 GAGAATGCATCCCTGAGGGTAGG - Intergenic
983419094 4:167495494-167495516 GAGAATGTGTCCCTGAGGGTAGG + Intergenic
984064276 4:175028639-175028661 GAGAATGCGTCCCTGAGGGTAGG - Intergenic
987102018 5:14599679-14599701 TGCAATGAACCCCAGAGGTTTGG + Intronic
987583294 5:19822962-19822984 GAGAATGCGTCCCTGAGGGTGGG - Intronic
990294415 5:54386071-54386093 AGGAATGGAACCCTCAGGGTTGG - Intergenic
990528599 5:56652397-56652419 TGGAATCAAACCCTGGGGGCAGG - Intergenic
991712544 5:69422372-69422394 GAGAATGCATCCCTGAGGGTAGG + Intronic
991991636 5:72345164-72345186 GAGAATGCATCCCTGAGGGTAGG - Intronic
993172420 5:84435907-84435929 AGGAATGCATTCCTGTGGGTAGG + Intergenic
994185623 5:96811817-96811839 TGAAATAAATGCCTGAGGGAGGG - Intergenic
995593983 5:113729265-113729287 GAGAATGCATCCCTGAGGGTAGG - Intergenic
996100061 5:119436736-119436758 GAGAATGTGTCCCTGAGGGTAGG + Intergenic
996753296 5:126910931-126910953 TAGAATGCGTCCCTGAGGGTAGG + Intronic
997920757 5:137977066-137977088 GAGAATGCACCCCTGAGGGTAGG + Intronic
998777248 5:145616954-145616976 GCGAATGCATCCCTGAGGGTAGG - Intronic
998904030 5:146884464-146884486 AGGAATGATTCCTTGAGAGTGGG - Intronic
998969986 5:147580554-147580576 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1000004427 5:157170059-157170081 GAGAATGTGTCCCTGAGGGTAGG + Intronic
1000237950 5:159380270-159380292 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1000408187 5:160911020-160911042 ATGAAGGAATACCTGAGGGTGGG - Intergenic
1000431014 5:161152486-161152508 TTAAATGAAGCCATGAGGGTGGG + Intergenic
1000562632 5:162809920-162809942 GAGAATGTGTCCCTGAGGGTGGG + Intergenic
1000615241 5:163419030-163419052 GAGAATGCGTCCCTGAGGGTGGG + Intergenic
1001065544 5:168532563-168532585 TGTGATGAAGCCCTGAGGCTGGG + Intergenic
1001189753 5:169618779-169618801 GAGAATGCGTCCCTGAGGGTAGG + Intergenic
1002064688 5:176646214-176646236 TGGAAAAAACTCCTGAGGGTGGG + Exonic
1002666413 5:180828896-180828918 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1002728164 5:181314725-181314747 TGGACTTAATCCCTGAGGCAAGG + Intergenic
1003079457 6:3009188-3009210 GAGAATGCGTCCCTGAGGGTGGG - Intronic
1003495934 6:6663214-6663236 TAAAATGAAGCCATGAGGGTGGG - Intergenic
1004058335 6:12163908-12163930 TGGAATGTGTGCCTGAGGGGCGG - Exonic
1004778234 6:18873193-18873215 GAGAATGTGTCCCTGAGGGTGGG + Intergenic
1006418087 6:33916818-33916840 GAGAATGTGTCCCTGAGGGTAGG - Intergenic
1008170706 6:48202269-48202291 GAGAATGCATCCCTGAGGGTAGG + Intergenic
1012676958 6:102127305-102127327 ATGAAGGAATACCTGAGGGTGGG + Intergenic
1013833175 6:114299132-114299154 GAGAATGCACCCCTGAGGGTGGG + Intronic
1014251388 6:119118975-119118997 GAGAATGCATCCCTAAGGGTAGG + Intronic
1014909578 6:127074987-127075009 TGCAATGAATCCATGAGGCATGG - Intergenic
1015000770 6:128211924-128211946 TGGAATCAATCAGTGAGGGCAGG - Intronic
1015545317 6:134355863-134355885 GAGAATGCATCCCTGAGGGTGGG + Intergenic
1016586830 6:145697630-145697652 GAGAATGCGTCCCTGAGGGTAGG - Intronic
1018149210 6:160922863-160922885 TGGAATAATTCCCAGAGGGGAGG + Intergenic
1018228265 6:161651399-161651421 CTGAATAAGTCCCTGAGGGTGGG + Intronic
1018811727 6:167303095-167303117 TGGAATGAACCCCTTTGGGTGGG + Intronic
1020328984 7:6999180-6999202 AGGAATGAATTCCTGGGGGAAGG + Intergenic
1020909355 7:14109065-14109087 GAGAATGCGTCCCTGAGGGTGGG - Intergenic
1021826760 7:24561210-24561232 TGGAATGACTCCCAGATGGGAGG - Intergenic
1022966911 7:35482533-35482555 TGACATGAATTCATGAGGGTGGG + Intergenic
1023565946 7:41523720-41523742 GAGAATGCCTCCCTGAGGGTAGG - Intergenic
1023969519 7:44980630-44980652 TGGCTTGACTCCCTGGGGGTTGG - Intergenic
1024072233 7:45795974-45795996 TGGACTTAATCCCTGAGGCAAGG + Intergenic
1024101493 7:46037075-46037097 TGGAGTCAATCCCAGAGGATGGG - Intergenic
1024409764 7:49026730-49026752 TCAAATGAATTCCTGAGGCTAGG - Intergenic
1025108931 7:56196511-56196533 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1025811211 7:64876832-64876854 TGGCAGGAATCCCTCAGTGTGGG + Intronic
1026879253 7:73898283-73898305 TAGAATGGATCCCTGAGGCCGGG - Intergenic
1027155250 7:75762845-75762867 TAGAATTAATCCCTGAGGCCTGG + Intergenic
1027976117 7:85158320-85158342 GAGAATGCATCCCTGAGGGGAGG + Intronic
1028400842 7:90423939-90423961 GAGAATGCGTCCCTGAGGGTAGG + Intronic
1028491809 7:91420991-91421013 TGTAAGAAATCACTGAGGGTTGG + Intergenic
1028999783 7:97141008-97141030 GAGAATGCATCCCTGAGGGGAGG + Intronic
1029556468 7:101273275-101273297 TGGAGAGAATCCCTGGGGATGGG + Intergenic
1031155948 7:118112494-118112516 TAGAAGGACTGCCTGAGGGTGGG - Intergenic
1031426970 7:121617016-121617038 GAGAATGCATCCCTGAGGGTAGG + Intergenic
1031763044 7:125738023-125738045 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1032049621 7:128639663-128639685 TGGACTTAATCCCTGAGGCAAGG + Intergenic
1033721204 7:144061199-144061221 GAGAATGTGTCCCTGAGGGTAGG + Intergenic
1034102523 7:148462689-148462711 AGGAATGCATCCCTGGGGGAAGG + Intergenic
1034609390 7:152352110-152352132 GCAAATGCATCCCTGAGGGTGGG + Intronic
1034929619 7:155151455-155151477 GCGAATGCATCCCTGAGGGTGGG + Intergenic
1035123658 7:156591392-156591414 GAGAACGCATCCCTGAGGGTAGG + Intergenic
1036113858 8:5936370-5936392 TGTAATGGAACCCTGAGGTTGGG - Intergenic
1036158335 8:6363283-6363305 GAGAATGCATCCCTGAGGGTAGG + Intergenic
1036531380 8:9591429-9591451 TTGGATGGATCCCTGAGAGTGGG + Intronic
1036981849 8:13478338-13478360 GGGAATGGATCCCTCAGGCTTGG - Intronic
1036994689 8:13642089-13642111 TGGAATGAATACATGATGATAGG + Intergenic
1037596210 8:20356369-20356391 TGGAAGGATTCCTTGAGGCTAGG + Intergenic
1039331049 8:36536926-36536948 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1039930518 8:41983633-41983655 TAGAATGAATTCCTGAAAGTGGG + Intronic
1040499447 8:47993997-47994019 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1040634296 8:49254505-49254527 GAGAATACATCCCTGAGGGTAGG + Intergenic
1041287479 8:56275286-56275308 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1041664937 8:60434030-60434052 GAGAATGCATACCTGAGGGTAGG - Intergenic
1042834225 8:73063493-73063515 TGGAATGAATGGCTGATGGTTGG - Intergenic
1043030894 8:75131865-75131887 TGTAAAGAATACCTGAGGCTGGG - Intergenic
1043144965 8:76641706-76641728 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1043684799 8:83071773-83071795 GAGAATGCATCCCTGAGGGTAGG - Intergenic
1043977483 8:86599579-86599601 GAGAATGTGTCCCTGAGGGTAGG + Intronic
1044039104 8:87343038-87343060 AGGAATGCATTCCTGGGGGTAGG - Intronic
1044070282 8:87751757-87751779 AGGAATGCATTCCTGGGGGTAGG - Intergenic
1044374952 8:91459604-91459626 TGGAATGAATACTTCAGGTTTGG + Intergenic
1046059248 8:109116788-109116810 TGCACTAAATCCCTGAGAGTAGG + Intronic
1047661927 8:127046787-127046809 AGGAATGCATTCCTGAGGGGAGG + Intergenic
1047688146 8:127322216-127322238 TGTAAAGAATACCTGAGGCTGGG - Intergenic
1048825742 8:138423874-138423896 GAGAATGCACCCCTGAGGGTAGG - Intronic
1051742561 9:20265846-20265868 GAGAATGAGTCCCTGAGGGTGGG + Intergenic
1052083828 9:24239398-24239420 GAGAATGCATCCCTGAGGGTAGG - Intergenic
1052426481 9:28311517-28311539 GAGAATGCGTCCCTGAGGGTAGG - Intronic
1052741020 9:32393259-32393281 GAGAATGCGTCCCTGAGGGTAGG + Intronic
1053703551 9:40726910-40726932 GAGAATGCACCCCTGAGGGTGGG + Intergenic
1054413609 9:64850373-64850395 GAGAATGCACCCCTGAGGGTGGG + Intergenic
1054790074 9:69248311-69248333 TGGAAGGCATTCCTAAGGGTTGG + Intronic
1055908069 9:81316500-81316522 GAGAATGTGTCCCTGAGGGTAGG - Intergenic
1056082829 9:83114606-83114628 CAGAATGCATCCCTGAGGGTAGG + Intergenic
1056508299 9:87278548-87278570 TGTAAAGAATACCTGAGAGTGGG - Intergenic
1057308799 9:93928432-93928454 TAAAATGAAGCCCTTAGGGTGGG - Intergenic
1057314105 9:93958134-93958156 GGGAATGAGGCCCTGAGGGCTGG + Intergenic
1057538828 9:95945180-95945202 GAGAATGCATCCCTGAGGGTAGG - Intronic
1057715716 9:97493753-97493775 GAGAATGCGTCCCTGAGGGTAGG - Intronic
1057962772 9:99472556-99472578 TGAAATGAATCTCTGAAGGCTGG - Intergenic
1058542858 9:106030196-106030218 AGGAATGCATCCCTGGGGGTAGG + Intergenic
1058720082 9:107756284-107756306 TGGAATGGGCGCCTGAGGGTAGG + Intergenic
1058936695 9:109776307-109776329 TGAAATGACTGCCTGATGGTTGG - Intronic
1059020513 9:110571440-110571462 TGGAAAGAATCCCTGATGGTAGG + Intronic
1059105933 9:111511627-111511649 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1059281824 9:113141059-113141081 GAGAATGTGTCCCTGAGGGTAGG + Intergenic
1061765569 9:132878943-132878965 TGGAGTGACTCCGTGAGTGTCGG - Exonic
1062753228 9:138271866-138271888 TGGACTTAATCCCTGAGGCAAGG + Intergenic
1203575741 Un_KI270745v1:6643-6665 TGGACTTAATCCCTGAGGCAAGG + Intergenic
1186150000 X:6664656-6664678 GAGAATGCATCCCTGAGGGTAGG - Intergenic
1186395403 X:9203498-9203520 TTGAATTCATCCATGAGGGTTGG - Intergenic
1187263843 X:17712660-17712682 TGGAATAAATCACTGTGGATTGG + Intronic
1187474297 X:19596919-19596941 TGAAAGTCATCCCTGAGGGTTGG + Intronic
1188802260 X:34547180-34547202 CTGAAGGAATACCTGAGGGTGGG + Intergenic
1188979434 X:36713814-36713836 GAGAATGCATCCCTGAGGGTAGG - Intergenic
1189388781 X:40558539-40558561 TAGAATGAATCCTTCAGGCTGGG + Intergenic
1189979000 X:46490222-46490244 GAGAATGCATCCCTGAGGGGAGG - Intronic
1190291241 X:48993848-48993870 TGGATTGCATCTCTGAGGTTGGG - Intronic
1190329686 X:49228153-49228175 AGGCATGCATCCCTCAGGGTAGG + Intronic
1190337523 X:49271109-49271131 CTGTATGAATCCTTGAGGGTAGG - Intronic
1190442032 X:50484207-50484229 TTAAATGAATCCATAAGGGTGGG - Intergenic
1190651354 X:52571855-52571877 GAGAACGCATCCCTGAGGGTAGG + Intergenic
1191064311 X:56331181-56331203 GAGAATGTGTCCCTGAGGGTAGG + Intergenic
1191980836 X:66923883-66923905 AAGAATGTGTCCCTGAGGGTAGG + Intergenic
1192059744 X:67811913-67811935 TAGAATGCATCCCTGAGGGTAGG - Intergenic
1192361434 X:70443293-70443315 AAGAATGAATCTCTGAGGGCCGG + Intergenic
1192842504 X:74871615-74871637 AGGAATGCATTCCTGGGGGTAGG - Intronic
1194535906 X:95105764-95105786 GAGAATGCATCCCTGAGGGTAGG + Intergenic
1194945972 X:100067806-100067828 TAGAATGAATCACTGAGTTTAGG - Intergenic
1195785273 X:108512984-108513006 GTGAATGCACCCCTGAGGGTGGG - Intronic
1196637061 X:118014267-118014289 AGAAATGCATTCCTGAGGGTAGG + Intronic
1197041370 X:121939804-121939826 AGGAATGCATTCCTGGGGGTAGG + Intergenic
1197138284 X:123088396-123088418 TGGAATGAAACACTGAGTATGGG + Intergenic
1197628607 X:128832192-128832214 AGGAATGCATTCCTGAGGGGAGG + Intergenic
1199477023 X:148257076-148257098 GAGAATGCGTCCCTGAGGGTAGG - Intergenic
1199785115 X:151098412-151098434 TGAAATGAGTCCCTGAGATTTGG + Intergenic
1200016263 X:153165999-153166021 CAGAGTGCATCCCTGAGGGTAGG + Intergenic
1200213928 X:154359143-154359165 TGAAAGGACTGCCTGAGGGTTGG + Exonic
1200713048 Y:6506427-6506449 GAGAATGTGTCCCTGAGGGTAGG - Intergenic
1200978655 Y:9240749-9240771 GAGAATGCATCCCTGAGGGTAGG + Intergenic
1201020873 Y:9655613-9655635 GAGAATGTGTCCCTGAGGGTAGG + Intergenic
1202132743 Y:21628571-21628593 GAGAATGCATCCCTGAGGGTAGG - Intergenic