ID: 901773474

View in Genome Browser
Species Human (GRCh38)
Location 1:11543198-11543220
Sequence GTGGAGAGGAGGCCTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901773474_901773484 18 Left 901773474 1:11543198-11543220 CCTTCCACAGGCCTCCTCTCCAC No data
Right 901773484 1:11543239-11543261 CAATACCCACCCCGCGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901773474 Original CRISPR GTGGAGAGGAGGCCTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr