ID: 901773484

View in Genome Browser
Species Human (GRCh38)
Location 1:11543239-11543261
Sequence CAATACCCACCCCGCGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901773479_901773484 -4 Left 901773479 1:11543220-11543242 CCTAAGCTCACTTCCTCCCCAAT No data
Right 901773484 1:11543239-11543261 CAATACCCACCCCGCGAAAAAGG No data
901773475_901773484 14 Left 901773475 1:11543202-11543224 CCACAGGCCTCCTCTCCACCTAA No data
Right 901773484 1:11543239-11543261 CAATACCCACCCCGCGAAAAAGG No data
901773474_901773484 18 Left 901773474 1:11543198-11543220 CCTTCCACAGGCCTCCTCTCCAC No data
Right 901773484 1:11543239-11543261 CAATACCCACCCCGCGAAAAAGG No data
901773477_901773484 4 Left 901773477 1:11543212-11543234 CCTCTCCACCTAAGCTCACTTCC No data
Right 901773484 1:11543239-11543261 CAATACCCACCCCGCGAAAAAGG No data
901773473_901773484 19 Left 901773473 1:11543197-11543219 CCCTTCCACAGGCCTCCTCTCCA No data
Right 901773484 1:11543239-11543261 CAATACCCACCCCGCGAAAAAGG No data
901773478_901773484 -1 Left 901773478 1:11543217-11543239 CCACCTAAGCTCACTTCCTCCCC No data
Right 901773484 1:11543239-11543261 CAATACCCACCCCGCGAAAAAGG No data
901773476_901773484 7 Left 901773476 1:11543209-11543231 CCTCCTCTCCACCTAAGCTCACT No data
Right 901773484 1:11543239-11543261 CAATACCCACCCCGCGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901773484 Original CRISPR CAATACCCACCCCGCGAAAA AGG Intergenic
No off target data available for this crispr