ID: 901776136

View in Genome Browser
Species Human (GRCh38)
Location 1:11561470-11561492
Sequence CCTCTGTGTCTCCGCGTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901776125_901776136 20 Left 901776125 1:11561427-11561449 CCTCCCTCACAGGCTGTGCCAAC No data
Right 901776136 1:11561470-11561492 CCTCTGTGTCTCCGCGTTCCCGG No data
901776128_901776136 2 Left 901776128 1:11561445-11561467 CCAACCTCTGTGTCCCTCCGATT No data
Right 901776136 1:11561470-11561492 CCTCTGTGTCTCCGCGTTCCCGG No data
901776129_901776136 -2 Left 901776129 1:11561449-11561471 CCTCTGTGTCCCTCCGATTCCCC No data
Right 901776136 1:11561470-11561492 CCTCTGTGTCTCCGCGTTCCCGG No data
901776124_901776136 21 Left 901776124 1:11561426-11561448 CCCTCCCTCACAGGCTGTGCCAA No data
Right 901776136 1:11561470-11561492 CCTCTGTGTCTCCGCGTTCCCGG No data
901776126_901776136 17 Left 901776126 1:11561430-11561452 CCCTCACAGGCTGTGCCAACCTC No data
Right 901776136 1:11561470-11561492 CCTCTGTGTCTCCGCGTTCCCGG No data
901776127_901776136 16 Left 901776127 1:11561431-11561453 CCTCACAGGCTGTGCCAACCTCT No data
Right 901776136 1:11561470-11561492 CCTCTGTGTCTCCGCGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901776136 Original CRISPR CCTCTGTGTCTCCGCGTTCC CGG Intergenic
No off target data available for this crispr