ID: 901776941

View in Genome Browser
Species Human (GRCh38)
Location 1:11566595-11566617
Sequence CTGTGCTGGCGGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901776941_901776948 9 Left 901776941 1:11566595-11566617 CCAGCCTCCCTCCGCCAGCACAG No data
Right 901776948 1:11566627-11566649 TTGCAGCTTCCAGCAGGCCACGG No data
901776941_901776947 3 Left 901776941 1:11566595-11566617 CCAGCCTCCCTCCGCCAGCACAG No data
Right 901776947 1:11566621-11566643 AGACACTTGCAGCTTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901776941 Original CRISPR CTGTGCTGGCGGAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr