ID: 901776948

View in Genome Browser
Species Human (GRCh38)
Location 1:11566627-11566649
Sequence TTGCAGCTTCCAGCAGGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901776939_901776948 30 Left 901776939 1:11566574-11566596 CCTGCAATGGCAGACAGGAGCCC No data
Right 901776948 1:11566627-11566649 TTGCAGCTTCCAGCAGGCCACGG No data
901776942_901776948 5 Left 901776942 1:11566599-11566621 CCTCCCTCCGCCAGCACAGTGCA No data
Right 901776948 1:11566627-11566649 TTGCAGCTTCCAGCAGGCCACGG No data
901776946_901776948 -5 Left 901776946 1:11566609-11566631 CCAGCACAGTGCAGACACTTGCA No data
Right 901776948 1:11566627-11566649 TTGCAGCTTCCAGCAGGCCACGG No data
901776940_901776948 10 Left 901776940 1:11566594-11566616 CCCAGCCTCCCTCCGCCAGCACA No data
Right 901776948 1:11566627-11566649 TTGCAGCTTCCAGCAGGCCACGG No data
901776944_901776948 1 Left 901776944 1:11566603-11566625 CCTCCGCCAGCACAGTGCAGACA No data
Right 901776948 1:11566627-11566649 TTGCAGCTTCCAGCAGGCCACGG No data
901776941_901776948 9 Left 901776941 1:11566595-11566617 CCAGCCTCCCTCCGCCAGCACAG No data
Right 901776948 1:11566627-11566649 TTGCAGCTTCCAGCAGGCCACGG No data
901776945_901776948 -2 Left 901776945 1:11566606-11566628 CCGCCAGCACAGTGCAGACACTT No data
Right 901776948 1:11566627-11566649 TTGCAGCTTCCAGCAGGCCACGG No data
901776943_901776948 2 Left 901776943 1:11566602-11566624 CCCTCCGCCAGCACAGTGCAGAC No data
Right 901776948 1:11566627-11566649 TTGCAGCTTCCAGCAGGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901776948 Original CRISPR TTGCAGCTTCCAGCAGGCCA CGG Intergenic
No off target data available for this crispr