ID: 901778450

View in Genome Browser
Species Human (GRCh38)
Location 1:11576637-11576659
Sequence AGGCTTGGGCCAGCAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901778450_901778463 25 Left 901778450 1:11576637-11576659 CCAGCACCTGCTGGCCCAAGCCT No data
Right 901778463 1:11576685-11576707 GGATCCAGCAGCTGCCCTTCCGG No data
901778450_901778458 4 Left 901778450 1:11576637-11576659 CCAGCACCTGCTGGCCCAAGCCT No data
Right 901778458 1:11576664-11576686 TGCCACAGGGTCTCCCTGCCAGG No data
901778450_901778455 -9 Left 901778450 1:11576637-11576659 CCAGCACCTGCTGGCCCAAGCCT No data
Right 901778455 1:11576651-11576673 CCCAAGCCTGGAGTGCCACAGGG No data
901778450_901778453 -10 Left 901778450 1:11576637-11576659 CCAGCACCTGCTGGCCCAAGCCT No data
Right 901778453 1:11576650-11576672 GCCCAAGCCTGGAGTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901778450 Original CRISPR AGGCTTGGGCCAGCAGGTGC TGG (reversed) Intergenic
No off target data available for this crispr